Guide to genetics: Difference between revisions
→Chromosome 21: a chromosome |
Justice12354 (talk | contribs) m Makes the Stoner mutation's title no longer red |
||
(40 intermediate revisions by 14 users not shown) | |||
Line 1: | Line 1: | ||
{{Speech | {{Needs revision|reason=Several new mutations were added and most mutations were tweaked or had values rebalanced in mid-2024, largely from PR #83652. More info needed on changes}}{{Speech | ||
|name=Ruth McVork | |name=Ruth McVork | ||
|text=Welcome to | |text=Welcome to [[Genetics]], brother! Are you feeling good? You SHOULD feel good! You are now like unto a tiny god! Are you prepared to be what you were born to be? Are you ready to save the station (or totally fuck it up)? | ||
''Chin up, buddy. It's not that hard. But before you start grabbing those monkeys from the pen, you should know the basics. | ''Chin up, buddy. It's not that hard. But before you start grabbing those monkeys from the pen, you should know the basics. | ||
|image=[[File:Geneticist.png|64px|right]] | |image=[[File:Geneticist.png|64px|right]] | ||
Line 9: | Line 9: | ||
== The Department == | == The Department == | ||
[[File:Genetics.png|thumb|240px|right]] | [[File:Genetics.png|thumb|240px|right]] | ||
Welcome to [[Genetics]]. | Welcome to [[Genetics]]. | ||
This room has two [[Machines#DNA_Scanner|DNA Scanners]] and two DNA Scanner Access Consoles, along with some disk boxes and other supplies. The disks are extremely useful, as we will see later. | This room has two [[Machines#DNA_Scanner|DNA Scanners]] and two DNA Scanner Access Consoles, along with some disk boxes and other supplies. The disks are extremely useful, as we will see later. | ||
A nearby containment room holds your test subjects. These monkeys are going to be your guinea pigs. You are going to experiment on them, and make them suffer quite a bit. It's pretty inhumane. But such is life, and after a while it will all be worth it. | A nearby containment room holds your test subjects. These monkeys are going to be your guinea pigs. You are going to experiment on them, and make them suffer quite a bit. It's pretty inhumane. But such is life, and after a while it will all be worth it. | ||
== [[File:scanner.gif|32px]][[File:Medcom.gif|32px]] DNA Modification == | |||
[[File:Unique_identifiers_tab.png|thumb|200px|right|This is the "Enzymes" tab. The "Radiation Emitter" function may randomize certain individual cosmetic features of the person inside, as well as damage their DNA. This menu can be used to transfer identities between people, but it can't be used to change a person's species. This information can also be stored on cloning data disks. Regarding the genetic research, listen to the direct orders of the [[Research Director]]]]. | |||
== [[File:scanner.gif| | |||
[[File:Unique_identifiers_tab.png|thumb|200px|right|This is the " | |||
Now, let's get you acquainted with the DNA Scanner Access Console. It has a few things of note. First you need to learn some terms: | Now, let's get you acquainted with the DNA Scanner Access Console. It has a few things of note. First you need to learn some terms: | ||
===Unique Enzymes=== | ===Unique Enzymes=== | ||
* Unique Enzymes (UE) = '''Your name'''. Even if you mutate the UE it will have no effect on the name. What you can do however, is to transfer UE from one person to another, copying their name. | * Unique Enzymes (UE) = '''Your name'''. Even if you mutate the UE it will have no effect on the name. What you can do however, is to transfer UE from one person to another, copying their name. | ||
===Unique Identifiers=== | ===Unique Identifiers=== | ||
* Unique Identifiers (UI) = '''Your cosmetic details''' - eye color, skin color, hair style, hair color and gender. <br> | * Unique Identifiers (UI) = '''Your cosmetic details''' - eye color, skin color, hair style, hair color and gender. <br> | ||
In the DNA scanner access console there is a tab named " | In the DNA scanner access console there is a tab named "Enzymes". This tab can be used to copy UE and UI between people. | ||
*Click "Save | *Click "Save" to save a person's UE + UI to the console. You can not save mutations this way (anymore). | ||
*Click " | *Click "Transfer" to copy the genes of the buffer to whoever is inside the scanner. You can choose between '''Enzymes''' (UE), '''Identity''' (UI) and '''Full Makeup''' (UE+UI). | ||
*Click " | *Click "Transfer (Delayed)" to copy the genes of the buffer to the next person who steps into the scanner and closes it (such as yourself). This option is only available if the scanner is empty. | ||
*Click " | *Click "Print" to print a DNA injector containing the genes of the saved buffer. Injecting this into a person will transfer the UE, UI or UE+UI to that person. Unlike mutation [[#Activators_and_Mutators|injectors]] however, these DNA injectors are not permanent, and will only last for a short while after injected. | ||
===Structural Enzymes=== | ===Structural Enzymes=== | ||
* Structural Enzymes (SE) / Genetic Sequence = '''Your mutations'''. They contain data relevant to your genetic structure. This governs your race and mutations. The term "Structural Enzymes" is no longer used by the DNA scanner access console since it was replaced with "Genetic Sequence" (which is the same thing), but the term may still show up elsewhere. | * Structural Enzymes (SE) / Genetic Sequence = '''Your mutations'''. They contain data relevant to your genetic structure. This governs your race and mutations. The term "Structural Enzymes" is no longer used by the DNA scanner access console since it was replaced with "Genetic Sequence" (which is the same thing), but the term may still show up elsewhere. | ||
=== Genetic Sequencer === | === Genetic Sequencer === | ||
[[File:Genetic_Sequencer.png|thumb|200px|right|This is what the | [[File:Genetic_Sequencer.png|thumb|200px|right|This is what the Sequencer tab may look like with a human in the scanner.]] | ||
In the DNA scanner access console there is a tab named " | In the DNA scanner access console there is a tab named "Sequencer". Here you will alter genes to find mutations. There are '''four''' types of blocks: A, T, C and G. Each pair of letters in the boxes are connected. '''A goes with T, and G goes with C.''' Order does not matter. Each pair has a correct combination of "AT, TG, CG or GC" that needs to be filled. If you see a an unmodified pair be X-T it means the right combination of that pair is A-T. When all 16 pairs have the right blocks, the mutation will activate and you will be able to store it. Monkeys can only have the ''monkified'' mutation unless [[#Humanizing_a_Monkey|humanized]]. Once you have found the name of a mutation, that mutation will be permanently identified in all DNA scanner access consoles. <br> | ||
You might want to disable the monkey mutation by replacing one of the healthy pairs with another letter. How to do all this will be detailed in [[#Guide_to_finding_and_using_mutations|the guide below]]. <br> | |||
====[[File:Gene_scanner.gif]] Genetic Sequence Scanner==== | ====[[File:Gene_scanner.gif]] Genetic Sequence Scanner==== | ||
[[File:Gene_scanner_results.png|thumb|200px|right|What it looks like after clicking someone with the "Genetic Sequence Scanner" item, and then using the Genetic Sequence Scanner in hand and selecting "Mutation 39". Note that we now know that the first pair should be C-G. ]] | [[File:Gene_scanner_results.png|thumb|200px|right|What it looks like after clicking someone with the "Genetic Sequence Scanner" item, and then using the Genetic Sequence Scanner in hand and selecting "Mutation 39". Note that we now know that the first pair should be C-G. ]] | ||
The more difficult mutations will have a lot of unknown (X-X) pairs. You cannot just randomly enter A-T, since it's predetermined what it's supposed to be. Knowing all this, you could whip out the genetic sequence scanner [[File:Gene_scanner.gif]] from your pocket. If you're looking for the correct pairs of mutation 39, scan people until you find a person with mutation 39. Then use the scanner in your hand for a menu to pop up. In the menu, select "mutation 39". This gives you a reading which will likely give you more information about which pairs you need to finish mutation 39. | The more difficult mutations will have a lot of unknown (X-X) pairs. You cannot just randomly enter A-T, since it's predetermined what it's supposed to be. Knowing all this, you could whip out the genetic sequence scanner [[File:Gene_scanner.gif]] from your pocket. If you're looking for the correct pairs of mutation 39, scan people until you find a person with mutation 39. Then use the scanner in your hand for a menu to pop up. In the menu, select "mutation 39". This gives you a reading which will likely give you more information about which pairs you need to finish mutation 39. | ||
[[File:Genetic_Sequencer_solved.png|thumb|200px|right|What it looks like after correctly filling all pairs. Mutation 39 turned out to be | [[File:Genetic_Sequencer_solved.png|thumb|200px|right|What it looks like after correctly filling all pairs. Mutation 39 turned out to be ''monkified''. Since solving a mutation activates it, the subject in the scanner is now a monkey.]]<br> | ||
You can use your Genetic Sequence Scanner [[File:Gene_scanner.gif]] on a DNA scanner access console to permanently synch the item, which makes you see the names of discovered mutations when scanning people with it.<br> | You can use your Genetic Sequence Scanner [[File:Gene_scanner.gif]] on a DNA scanner access console to permanently synch the item, which makes you see the names of discovered mutations when scanning people with it.<br> | ||
More info about some of the other tabs can be found in the [[#Guide_to_finding_and_using_mutations|guide further below]]. | More info about some of the other tabs can be found in the [[#Guide_to_finding_and_using_mutations|guide further below]]. | ||
=== [[File:Hulk.png | ===[[File:Hulk.png]] List of Mutations=== | ||
{{Anchor|Mutations and Their Consequences}} | {{Anchor|Mutations and Their Consequences}} | ||
Before we start splicing, you must know what possible monstrosities can be done to a human. | Before we start splicing, you must know what possible monstrosities can be done to a human. | ||
Normally unobtainable mutations are highlighted in red text. | |||
{| class="wikitable sortable | {| class="wikitable sortable mw-collapsible" border="1" cellspacing="0" cellpadding="2" | ||
! style='background-color:#3BB9FF; | ! style='background-color:#3BB9FF;'|Mutation Name | ||
! style='background-color:#3BB9FF;'|Description | ! style='background-color:#3BB9FF;'|Description | ||
! style='background-color:#3BB9FF; | ! style='background-color:#3BB9FF;'|Indicators | ||
! style='background-color:#3BB9FF; | ! style='background-color:#3BB9FF;'|Message | ||
! style='background-color:#3BB9FF; | ! style='background-color:#3BB9FF;'|How/Where to Obtain | ||
! style='background-color:# | ! style='background-color:#FF7F56;'|Instability | ||
|- | |- | ||
! | !Adrenaline Rush | ||
| | |"Allows the host to trigger their body's adrenaline response at will." | ||
| | |\ | ||
|style='color:#0000ff'|''"You feel | |style='color:#0000ff'|''"You feel pumped up!"'' | ||
| | |Genetics | ||
| | |{{Positiveinstabilitymoderate}} | ||
|- | |- | ||
! | !Cold Adaptation | ||
| | |''"A strange mutation that renders the host immune to damage from low temperature environments. It also prevents the host from slipping on ice."'' | ||
|Subject | |||
|style='color:#0000ff'|''"Your | '''This mutation is mutually exclusive with Heat, Thermal, and Pressure Adaptation.''' | ||
| | |Subject has a pulsating blue "aura". | ||
| | |style='color:#0000ff'|''"Your body feels refreshingly cold."'' | ||
|Genetics | |||
|{{Positiveinstabilitymoderate}} | |||
|- | |- | ||
! | !Heat Adaptation | ||
| | |''"A strange mutation that renders the host immune to damage from high temperature, including being set alight, though the flame itself still burns clothing. It also seems to make the host resist ash storms."'' | ||
|Subject has a pulsating orange | |||
|style='color:#0000ff'|''"Your body feels warm."'' | '''This mutation is mutually exclusive with Cold, Thermal, and Pressure Adaptation.''' | ||
| | |Subject has a pulsating orange "aura". | ||
| | |style='color:#0000ff'|''"Your body feels invigoratingly warm."'' | ||
|Genetics | |||
|{{Positiveinstabilitymoderate}} | |||
|- | |- | ||
!Thermal | !Thermal Adaptation | ||
| | |''"A strange mutation that renders the host immune to damage from both low and high temperature environments. Does not protect from high or low pressure environments."'' | ||
| | |||
|style='color:#0000ff'|''" | '''This mutation is mutually exclusive with Cold, Heat, and Pressure Adaptation.''' | ||
| | |Subject has a pulsating green "aura". | ||
| | |style='color:#0000ff'|''"Your body feels pleasantly room temperature."'' | ||
|Cold Adaptation + Heat Adaptation | |||
|{{Positiveinstabilitymajor}} | |||
|- | |- | ||
! | !Pressure Adaptation | ||
| | |''"A strange mutation that renders the host immune to damage from both low and high pressure environments. Does not protect from temperature, including the cold of space."'' | ||
|Subject | |||
|style='color:#0000ff'|''" | '''This mutation is mutually exclusive with Cold, Heat, and Thermal Adaptation.''' | ||
| | |Subject has a pulsating pink "aura". | ||
| | |style='color:#0000ff'|''"Your body feels numb."'' | ||
|Genetics | |||
|{{Positiveinstabilitymoderate}} | |||
|- | |- | ||
! | !Antenna | ||
|The | |''"The affected person sprouts an antenna. This is known to allow them to access common radio channels passively."'' | ||
|Subject | |Subject displays an antenna located on their head. | ||
|style='color:# | |style='color:#0000FF'|''"You feel an antenna sprout from your forehead."'' | ||
| | |Genetics | ||
| | |{{Positiveinstabilityminor}} | ||
|- | |- | ||
! | !Mind Reader | ||
| | |''"The affected person can look into the recent memories of others."'' | ||
|Subject | Subject displays the ability to read others' minds, learning their names and snippets of their past. | ||
|style='color:# | Tin foil is known to block this. | ||
| | |Subject displays an antenna located on their head. | ||
| | |style='color:#0000FF'|''"You hear distant voices at the corners of your mind."'' | ||
|Antenna + Paranoia / [[Sects|Punished God sect]] | |||
|{{Positiveinstabilityminor}} | |||
|- | |- | ||
! | !Autotomy | ||
| | |''"Allows a creature to voluntary discard a random appendage."'' | ||
|\ | |\ | ||
|style='color:# | |style='color:#0000FF'|''"Your joints feel loose."'' | ||
| | |Genetics | ||
|{{Positiveinstabilityminor}} | |||
|- | |- | ||
!Epilepsy | !Epilepsy | ||
|Subject | |''"A genetic defect that sporadically causes seizures."'' | ||
|Subject | Subject periodically falls down and starts shaking. | ||
|Subject suffers from seizures. | |||
|style='color:#ff0000'|''"You get a headache."'' | |style='color:#ff0000'|''"You get a headache."'' | ||
| | |Genetics | ||
|{{Negativestabilitymoderate}} | |||
|- | |- | ||
! | !Cough | ||
| | |''"A chronic cough."'' | ||
Subject periodically coughs, drop any items they're holding. Substantially harmless, but tends to get on the nerves of the subject. | |||
|Subject coughs. | |Subject coughs. | ||
|style='color:#ff0000'|''"You start coughing."'' | |style='color:#ff0000'|''"You start coughing."'' | ||
| | |Genetics | ||
|{{Negativestabilitymoderate}} | |||
|- | |- | ||
! | !Paranoia | ||
| | |''"Subject is easily terrified, and may suffer from hallucinations."'' | ||
|Subject | |Subject screams frequently. | ||
|style='color:# | |style='color:#FF0000'|''"You feel screams echo through your mind..."'' | ||
| | |Genetics | ||
|{{Negativestabilitymoderate}} | |||
|- | |- | ||
! | !Dwarfism | ||
| | |''"A mutation believed to be the cause of dwarfism."'' | ||
|Subject | Subject turns into a manlet, making them unusually shorter than the rest of the crew. Dwarfs can pass over tables without stopping and are known to have less tolerance to mutations. | ||
|style='color:# | |||
| | '''This mutation is mutually exclusive with Acromegaly and Gigantism.''' | ||
|Subject looks smaller. | |||
|style='color:#0000ff'|''"Everything around you seems to grow.."'' | |||
|Human Species | |||
|{{Positiveinstabilityminor}} | |||
|- | |- | ||
! | !Acromegaly | ||
| | |''"A mutation believed to be the cause of acromegaly, or 'being unusually tall'."'' | ||
Subject's legs and torso become more extensive. Not the same as Gigantism. | |||
|style='color:# | |||
| | '''This mutation is mutually exclusive with Dwarfism.''' | ||
|Subject looks taller. | |||
|style='color:#0000ff'|''"You feel a small strange urge to fight small men with slingshots. Or maybe play some basketball."'' | |||
|[[Quirks#Spacer|Spacer Quirk]] | |||
|{{Negativestabilitymoderate}} | |||
|- | |- | ||
! | !Gigantism | ||
| | |''"The cells within the subject spread out to cover more area, making them appear larger."'' | ||
| | Subject shows increased tackling abilities, both offensive and defensive. Not the same as Acromegaly. | ||
|style='color:# | |||
| | '''This mutation is mutually exclusive with Dwarfism.''' | ||
|Subject is slightly larger than normal. | |||
|style='color:#0000ff'|''"Everything around you seems to shrink.."'' | |||
|Genetics | |||
|0 | |||
|- | |- | ||
!Clumsiness | !Clumsiness | ||
|Subject | |''"A genome that inhibits certain brain functions, causing the holder to appear clumsy. Honk!"'' | ||
Subject displays clown-like clumsiness, accidentally dropping objects they hold, and being unable to use tasers, handcuffs, guns without them exploding back in their face. | |||
|\ | |\ | ||
|style='color:#ff0000'|''"You feel lightheaded."'' | |style='color:#ff0000'|''"You feel lightheaded."'' | ||
| | |Genetics / [[Clown|Clowns]] | ||
|{{Negativestabilitymajor}} | |||
|- | |- | ||
! | !Tourette's Syndrome | ||
| | |''"A chronic twitch that forces the user to scream bad words."'' | ||
| | Subject swears all the time and may also periodically experience paralysis. | ||
|style='color:#ff0000'|''"You | |Subject curses out loudly and twitches. | ||
| | |style='color:#ff0000'|''"You twitch."'' | ||
|Genetics | |||
|0 | |||
|- | |- | ||
! | !Deafness | ||
| | |''"The holder of this genome is completely deaf."'' | ||
|\ | |\ | ||
|style='color:#ff0000'|''"You | |style='color:#ff0000'|''"You can't seem to hear anything..."'' | ||
| | |Genetics | ||
|{{Negativestabilitymajor}} | |||
|- | |- | ||
! | !Monkified | ||
| | |''"A strange genome, believing to be what differentiates monkeys from humans."'' | ||
| | Subject transforms into a monkey. Innate mutation in humans and monkeys. | ||
|''"You feel | |Subject is a monkey. | ||
| | |''"You feel unusually monkey-like."'' | ||
|Human and Monkey Species | |||
|{{Negativestabilitymajor}} | |||
|- | |- | ||
!Glowy | !Glowy | ||
| | |''"You permanently emit a light with a random color and intensity."'' | ||
'''This mutation is mutually exclusive with Anti-Glow.''' | |||
|Subject glows. | |Subject glows. | ||
|style='color:#0000ff'|''"Your skin begins to glow softly."'' | |style='color:#0000ff'|''"Your skin begins to glow softly."'' | ||
| | |Genetics | ||
| | |{{Positiveinstabilitymini}} | ||
|- | |- | ||
!Anti-Glow | !Anti-Glow | ||
| | |''"Your skin seems to attract and absorb nearby light creating 'darkness' around you."'' | ||
|Subject has an aura of darkness. | Subject absorbs light in a radius around it. Works on Ethereals and Luminescents. | ||
|style='color:#0000ff'|''" | |||
'''This mutation is mutually exclusive with Glow.''' | |||
|Subject has an aura of darkness. | |||
|style='color:#0000ff'|''"The light around you seems to disappear."'' | |||
|Glowy + Void Magnet | |Glowy + Void Magnet | ||
| | |{{Positiveinstabilityminor}} | ||
|- | |- | ||
!Strength | !Strength | ||
|Subject | |''"The user's muscles slightly expand. Commonly seen in top-ranking boxers."'' | ||
| | Subject displays better fitness and fishing skills, requiring less rest time. | ||
|"You feel | |\ | ||
| | |style='color:#0000ff'|''"You feel stronger"'' | ||
|Genetics | |||
|{{Positiveinstabilitymini}} | |||
|- | |||
!Stimmed | |||
|''"The user's chemical balance is more robust. This mutation is known to slightly improve workout efficiency."'' | |||
|\ | |||
|style='color:#0000FF'|''"You feel stimmed."'' | |||
|Genetics | |||
|{{Positiveinstabilitymini}} | |||
|- | |||
!Insulated | |||
|''"The affected person does not conduct electricity."'' | |||
|\ | |||
|style='color:#0000ff'|''"Your fingertips go numb."'' | |||
|Genetics | |||
|{{Positiveinstabilitymoderate}} | |||
|- | |- | ||
! | !Fiery Sweat | ||
| | |''"The user's skin will randomly combust, but is generally a lot more resilient to burning."'' | ||
|Subject | Subject's [[#Genetic_Instability|genetic stability]] decreases odds of combustion. | ||
'''This mutation is mutually exclusive with Heat Adaptation.''' | |||
|Subject spontaneously combusts. | |||
|style='color:#ff0000'|''"You feel hot."'' | |style='color:#ff0000'|''"You feel hot."'' | ||
| | |Genetics | ||
|0 | |||
|- | |||
!Spatial Instability | |||
|''"The victim of the mutation has a very weak link to spatial reality, and may be displaced. Often causes extreme nausea."'' | |||
|Subject randomly teleports a short distance away. | |||
|style='color:#FF0000'|''"The space around you twists sickeningly."'' | |||
|Genetics | |||
|{{Negativestabilitymoderate}} | |||
|- | |||
!Acidic Flesh | |||
|''"Subject has acidic chemicals building up underneath the skin. This is often lethal."'' | |||
Those buildups end up as acidic cutaneous eruptions, burning the subject. Acid-resistant clothes have been shown to protect the subject from these. | |||
|Subject's skin frequently bubbles and pops, burning them. | |||
|style='color:#FF0000'|''"A horrible burning sensation envelops you as your flesh turns to acid!"'' | |||
|Genetics | |||
|{{Negativestabilitymajor}} | |||
|- | |||
!Spastic | |||
|''"Subject suffers from muscle spasms."'' | |||
Subject may unintentionnally hit nearby people and machinery, and harm themselves. | |||
|Subject frequently spasms. | |||
|style='color:#FF0000'|''"You flinch."'' | |||
|Genetics | |||
|{{Negativestabilitymoderate}} | |||
|- | |||
!Two Left Feet | |||
|''"A mutation that replaces the right foot with another left foot. Symptoms include kissing the floor when taking a step."'' | |||
|Subject is randomly [[Status_Effects#Knockdown|knocked down]]. | |||
|style='color:#FF0000'|''"Your right foot feels... left."'' | |||
|Genetics | |||
|{{Negativestabilitymoderate}} | |||
|- | |||
!Internal Martyrdom | |||
|''"A mutation that makes the body destruct when near death. Not damaging, but very, VERY disorienting."'' | |||
Subject melts into gibs upon death. Harmful to witnesses' eyes and temporarily overloads Silicons. | |||
|Subject explodes in a bloody shower when near death. | |||
|style='color:#0000FF'|''"You get an intense feeling of heartburn."'' | |||
|Strong + Stimmed | |||
|{{Negativestabilitymajor}} | |||
|- | |- | ||
! | !H.A.R.S. | ||
| | |''"A mutation that makes the body reject the head, the brain receding into the chest. Stands for Head Allergic Rejection Syndrome. Warning: Removing this mutation is very dangerous, though it will regenerate non-vital head organs."'' | ||
| | |Subject lacks a head. | ||
|" | |style='color:#FF0000'|''"Something feels off."'' | ||
| | |Genetics | ||
| | |{{Negativestabilitymajor}} | ||
|- | |- | ||
! | !Hypermetabolic Blood | ||
| | |''"The subject's blood is hypermetabolic, causing it to be produced at a much faster rate."'' | ||
| | |\ | ||
|style='color:# | |style='color:#0000ff'|''"You can feel your heartbeat pick up."'' | ||
| | |Genetics | ||
| | |{{Positiveinstabilityminor}} | ||
|- | |- | ||
! | !Rock Eater | ||
| | |''"The subject's body is able to digest rocks and minerals."'' | ||
|style='color:#0000ff'|''"You | '''This mutation is mutually exclusive with Rock Absorber.''' | ||
| | |\ | ||
| | |style='color:#0000ff'|''"You feel a craving for rocks."'' | ||
|Genetics | |||
|{{Positiveinstabilityminor}} | |||
|- | |- | ||
! | !Rock Absorber | ||
| | |''"The subject's body is able to digest rocks and minerals, taking on their properties."'' | ||
|style='color:#0000ff'|''"You feel a | '''This mutation is mutually exclusive with Rock Eater.''' | ||
| | |\ | ||
| | |style='color:#0000ff'|''"You feel a supreme craving for rocks."'' | ||
|Rock Eater + Stoner | |||
|{{Positiveinstabilitymajor}} | |||
|- | |- | ||
! | !Inexorable | ||
| | |''"Your body can push on beyond the limits of normal human endurance. However, pushing it too far can cause severe damage to your body."'' | ||
|\ | |\ | ||
|''"You feel | |style='color:#0000ff'|''"You feel inexorable."'' | ||
|Genetics | |||
|{{Positiveinstabilitymoderate}} | |||
|- | |||
!Chameleon | |||
|''"A genome that causes the holder's skin to become transparent over time."'' | |||
Subject subtly alters light patterns to become invisible, as long as they remain still. | |||
|Subject starts fading into the background. | |||
|style='color:#0000ff'|"''You feel one with your surroundings.''" | |||
|Genetic | |Genetic | ||
|{{Positiveinstabilitymajor}} | |||
|- | |||
!Geladikinesis | |||
|''"Allows the user to concentrate moisture and sub-zero forces into snow."'' | |||
|\ | |||
|style='color:#0000ff'|''"Your hand feels cold."'' | |||
|Genetics | |||
|{{Positiveinstabilityminor}} | |||
|- | |- | ||
! | !Cryokinesis | ||
| | |''"Draws negative energy from the sub-zero void to freeze surrounding temperatures at subject's will."'' | ||
|\ | |\ | ||
|''" | |style='color:#0000ff'|''"Your hand feels cold."'' | ||
| | |Genetics | ||
|{{Positiveinstabilitymoderate}} | |||
|- | |- | ||
! | !Farsight | ||
| | |''"The subject's eyes are able to see further than normal."'' | ||
|\ | |\ | ||
|''"You feel | |style='color:#0000ff'|''"You feel your eyes tingle."'' | ||
| | |Genetics | ||
|{{Positiveinstabilityminor}} | |||
|- | |- | ||
! | !Fire Breath | ||
| | |''"An ancient mutation that gives lizards breath of fire."'' | ||
| | |\ | ||
|''" | |style='color:#0000ff'|''"Your throat is burning!"'' | ||
| | |Lizard Species | ||
|{{Positiveinstabilitymoderate}} | |||
|- | |- | ||
! | !Cindikinesis'' | ||
| | |''"Allows the user to concentrate nearby heat into a pile of ash. Wow. Very interesting."'' | ||
| | |\ | ||
|style='color:# | |style='color:#0000ff'|''"Your hand feels warm."'' | ||
| | |Geladikinesis + Fiery Sweat | ||
|{{Positiveinstabilityminor}} | |||
|- | |- | ||
! | !Pyrokinesis | ||
|This | |''"Draws positive energy from the surroundings to heat surrounding temperatures at subject's will."'' | ||
| | |\ | ||
|style='color:#0000ff'|''"Your | |style='color:#0000ff'|''"Your hand feels hot!"'' | ||
| | |Cryokinesis + Fiery Sweat | ||
| | |{{Positiveinstabilitymoderate}} | ||
|-{{Anchor|Hulk}} | |||
!Hulk | |||
|''"A poorly understood genome that causes the holder's muscles to expand, inhibit speech and gives the person a bad skin condition."'' | |||
Subject becomes extremely strong, enough to punch through reinforced walls, and is unable to speak without yelling. Subject is also immune to stuns and slowdowns from stamina and normal damage, and cannot be pushed past. Breaking walls and machinery heavily damages to their arms. This mutation fades away when the subject falls in a critical state. Only works on human subjects. | |||
* Can swing people by their tails. To do this, they must grab their victim in at least a neck grab (lvl 3 grab), enable throw mode, then click in the direction they want to throw. | |||
* Makes them more vulnerable to cold and take brute damage from it. | |||
* Prevent them from using guns, batons and computers, and wielding items with both hands. | |||
'''This mutation is mutually exclusive with Ork.''' | |||
|Subject turns green and has red eyes. | |||
|style='color:#0000ff'|''"Your muscles hurt."'' | |||
|Radioactive + Strength | |||
|{{Positiveinstabilitymajor}} | |||
|- | |- | ||
! | !Ork | ||
|This | |''"A mutation caused by a mixup of hulk genes which severely impacts speech centers in owners' brains."'' | ||
| | Works the same as [[Guide_to_genetics#Hulk|Hulk]] but you may verbalize some words in Ork Language. | ||
|style='color:#0000ff'|''"You feel | |||
| | '''This mutation is mutually exclusive with Hulk.''' | ||
| | |Subject turns brown and has red eyes. | ||
|style='color:#0000ff'|''"You feel significantly dumber!"'' | |||
|Hulk + Clumsy | |||
|{{Positiveinstabilitymajor}} | |||
|- | |- | ||
!Transcendent Olfaction | !Transcendent Olfaction | ||
| | |''"Your sense of smell is comparable to that of a canine."'' | ||
Subject displays the ability to track the scent of anyone who interacted with a certain object. | |||
|\ | |||
|style='color:#0000ff'|''"Smells begin to make more sense..."'' | |style='color:#0000ff'|''"Smells begin to make more sense..."'' | ||
| | |Genetics | ||
| | |{{Positiveinstabilitymoderate}} | ||
|- | |||
!Biotech Compatibility | |||
|''"Subject is more compatibile with biotechnology such as skillchips."'' | |||
Subject displays tolerance to higher skillchip complexity capacity than average. | |||
|\ | |||
|\ | |||
|Genetics | |||
|{{Positiveinstabilityminor}} | |||
|- | |||
!Clever | |||
|''"Causes the subject to feel just a little bit smarter. Most effective in specimens with low levels of intelligence."'' | |||
Subject displays skills in advanced actions such as surgery and machinery interaction, despite low levels of intelligence. | |||
|\ | |||
|style='color:#FF0000'|''"You feel a little bit smarter."'' | |||
|Genetics | |||
|{{Positiveinstabilitymoderate}} | |||
|- | |||
!Radioactivity | |||
|''"A volatile mutation that causes the host to sent out deadly beta radiation. This affects both the hosts and their surroundings."'' | |||
|Subject glows with a green aura | |||
|style='color:#ff0000'|''"You can feel it in your bones!"'' | |||
|Genetics | |||
|{{Negativestabilitymajor}} | |||
|- | |||
!Telekinesis | |||
|''"A strange mutation that allows the holder to interact with objects through thought."'' | |||
Subject can control objects with their mind, from far away! It is the most sought after power, since it allows for incredible deeds, and makes a strong robuster nearly immortal. To use it, switch to an empty hand and click on an object (note that, if they can, your character/the game will prioritize picking up an object normally over picking it up telekinetically). A circle symbol will appear underneath the object and in your hand and you can now control the object. Subject can also use any console from a distance. | |||
|Appears as a blue glow around the subject's head. | |||
|style='color:#0000ff'|''"You feel smarter"'' | |||
|Genetics / [[Sects|Punished God sect]] | |||
|{{Positiveinstabilitymajor}} | |||
|- | |||
!Elastic Arms | |||
|''"Subject's arms have become elastic, allowing them to stretch up to a meter away. However, this elasticity makes it difficult to wear gloves, handle complex tasks, or grab large objects."'' | |||
Subject can grab objects and interact (help, attack, and grab) with mobs up to two tiles away unless there is a structure, like a table, or mob in the way. They cannot pull others around while using your elastic arms. Their fingers will become chunky, so you can't use guns, batons and computers. Subject also cannot wield items with both hands. | |||
|\ | |||
|style='color:#ff0000'|''"You feel armstrong!"'' | |||
|Genetics | |||
|{{Positiveinstabilitymajor}} | |||
|- | |||
!Near Sightness | |||
|''"The holder of this mutation has poor eyesight."'' | |||
Subject displays difficulty to see objects far away. Perscription glasses are recommended. | |||
|\ | |||
|style='color:#ff0000'|''"You can't see very well."'' | |||
|Genetics | |||
|{{Negativestabilitymoderate}} | |||
|- | |||
!Blindness | |||
|''"Renders the subject completely blind."'' | |||
|Subject's eyes don't react to penlight. | |||
|style='color:#ff0000'|''"You can't seem to see anything."'' | |||
|Genetics | |||
|{{Negativestabilitymajor}} | |||
|- | |||
!Thermal Vision | |||
|''"The user of this genome can visually perceive the unique human thermal signature."'' | |||
Subject can see people even through walls and in darkness for 10 seconds, for the cost of 10 eye damage. | |||
|\ | |||
|style='color:#0000ff'|''"You can see the heat rising off of your skin..."'' | |||
|Genetics | |||
|{{Positiveinstabilitymajor}} | |||
|- | |||
!Illiterate | |||
|''"Causes a severe case of Aphasia that prevents reading or writing."'' | |||
Subject suffers from illiteracy, becoming unable to use paper, pens, computers, and electronics that require reading. | |||
|\ | |||
|style='color:#ff0000'|''"You feel unable to read or write."'' | |||
|Genetics | |||
|{{Negativestabilitymajor}} | |||
|- | |||
!Nervousness | |||
|''"Causes the holder to stutter."'' | |||
|Subject stammers when they speak. | |||
|style='color:#ff0000'|''"You feel nervous."'' | |||
|Genetics | |||
|{{Negativestabilitymini}} | |||
|- | |||
!Wacky | |||
|''"You are not a clown. You are the entire circus."'' | |||
Subject speaks in an odd manner. | |||
|\ | |||
|''"You feel an off sensation in your voicebox."'' | |||
|Genetics | |||
|{{Negativestabilitymini}} | |||
|- | |||
!Heckacious larincks | |||
|''"duge what is WISH your words man..........."'' | |||
Subject's language center is affected into forming sentences in a stoned manner. | |||
|\ | |||
|style='color:#0000FF'|''"duge what is WISH your words man..........."'' | |||
|Wacky + Stoner | |||
|0 | |||
|- | |- | ||
! | !Mute | ||
| | |''"Completely inhibits the vocal section of the brain."'' | ||
| | |\ | ||
|style='color:# | |style='color:#ff0000'|''"You feel unable to express yourself at all."'' | ||
| | |Genetics / [[Sects|Punished God sect]] | ||
| | |{{Negativestabilitymajor}} | ||
|- | |- | ||
! | !Unintelligible | ||
| | |''"Partially inhibits the vocal center of the brain, severely distorting speech."'' | ||
| | Subject can only speak in short sentences. | ||
|style='color:# | |\ | ||
| | |style='color:#ff0000'|''"You can't seem to form any coherent thoughts!"'' | ||
| | |Genetics | ||
|{{Negativestabilitymoderate}} | |||
|- | |- | ||
! | !Swedish | ||
| | |''"A horrible mutation originating from the distant past. Thought to be eradicated after the incident in 2037."'' | ||
Subject's language center is affected into forming sentences in a vaguely norse manner. | |||
|style='color:# | |\ | ||
| | |style='color:#0000ff'|''"You feel Swedish, however that works."'' | ||
| | |Genetics | ||
|{{Negativestabilitymini}} | |||
|- | |- | ||
! | !Chav | ||
| | |''"Unknown"'' | ||
| | Subject's language center is affected into forming sentences in a more rudimentary manner. | ||
|style='color:# | |\ | ||
| | |style='color:#0000ff'|''"Ye feel like a reet prat like, innit?"'' | ||
| | |Genetics | ||
|{{Negativestabilitymini}} | |||
|- | |- | ||
! | !Elvis | ||
| | |''"A terrifying mutation named after its 'patient-zero'."'' | ||
| | Subject's language center is affected into forming sentences like the King of Rock and Roll. | ||
|style='color:# | |\ | ||
| | |style='color:#0000FF'|''"You feel pretty good, honeydoll."'' | ||
| | |Genetics | ||
|{{Negativestabilitymini}} | |||
|- | |- | ||
! | !Stoner | ||
|Subject is | |''"A common mutation that severely decreases intelligence."'' | ||
| | Subject's language center is affected into only being able to speak with other Beach folks. | ||
|style='color:# | |\ | ||
| | |style='color:#0000FF'|''"You feel...totally chill, man!"'' | ||
|Genetics / Beach Bum | |||
|0 | |||
|- | |- | ||
! | !Medieval | ||
| | |''"A horrible mutation originating from the distant past, thought to have once been a common gene in all of old world Europe."'' | ||
Subject's language center is affected into forming sentences in a medieval manner. | |||
|''" | |\ | ||
| | |style='color:#0000FF'|''"You feel like seeking the holy grail!."'' | ||
|Genetics | |||
|{{Negativestabilitymini}} | |||
|- | |- | ||
! | !Pig Latin | ||
| | |''"Historians say back in the 2020's humanity spoke entirely in this mystical language."'' | ||
Subject's language center is affected into forming sentences in an odd manner. | |||
|style='color:# | |\ | ||
| | |style='color:#0000FF'|''"Omethingsay eelsfay offyay."'' | ||
|Genetics | |||
|{{Negativestabilitymini}} | |||
|- | |- | ||
! | !Telepathy | ||
| | |''"A rare mutation that allows the user to telepathically communicate to others."'' | ||
|\ | |\ | ||
|style='color:# | |style='color:#0000ff'|''"You hear your thoughts echo in your mind"'' | ||
| | |Genetics / [[Sects|Punished God sect]] | ||
| | |{{Positiveinstabilityminor}} | ||
|- | |- | ||
!Tongue Spike | !Tongue Spike | ||
|Allows a creature to voluntary shoot their tongue out as a deadly weapon. | |''"Allows a creature to voluntary shoot their tongue out as a deadly weapon."'' | ||
|\ | |\ | ||
|style='color:#0000FF'|''"Your feel like you can throw your voice."'' | |style='color:#0000FF'|''"Your feel like you can throw your voice."'' | ||
| | |Genetics | ||
|{{Positiveinstabilitymini}} | |||
| | |||
|- | |- | ||
!Chem Spike | !Chem Spike | ||
|Allows a creature to voluntary shoot their tongue out as biomass, allowing a long range transfer of chemicals. | |''"Allows a creature to voluntary shoot their tongue out as biomass, allowing a long range transfer of chemicals."'' | ||
|\ | |\ | ||
|style='color:#0000FF'|''"Your feel like you can really connect with people by throwing your voice."'' | |style='color:#0000FF'|''"Your feel like you can really connect with people by throwing your voice."'' | ||
|Tongue Spike + Stimmed | |Tongue Spike + Stimmed | ||
| | |{{Positiveinstabilityminor}} | ||
|- | |||
!Shock Touch | |||
|''"The affected can channel excess electricity through their hands without shocking themselves, allowing them to shock others. Mostly harmless! Mostly... "'' | |||
|\ | |||
|style='color:#0000ff'|''"You feel power flow through your hands."'' | |||
|Insulated + Radioactive | |||
|{{Positiveinstabilitymoderate}} | |||
|- | |||
!Mending Touch | |||
|''"The affected can lay their hands on other people to transfer a small amount of their injuries to themselves."'' | |||
|\ | |||
|style='color:#0000ff'|''"Your hand feels blessed!"'' | |||
|Genetics | |||
|{{Positiveinstabilitymajor}} | |||
|- | |||
!Void Magnet | |||
|"''A rare genome that attracts odd forces not usually observed.''" | |||
Subject's [[#Genetic_Instability|genetic stability]] decreases odds of anormality occurrence. Subject enters an immovable state of void-self against their will. | |||
|Subject is periodically replaced with a hole in reality shaped like itself. | |||
|style='color:#0000ff'|''"You feel a heavy, dull force just beyond the walls watching you."'' | |||
|Genetics | |||
|{{Positiveinstabilitymoderate}} | |||
|- | |- | ||
!Webbing Production | !Webbing Production | ||
|Allows the user to lay webbing, and travel through it. | |''"Allows the user to lay webbing, and travel through it."'' | ||
| | |Subject can navigate through webbing unaffected. | ||
|style='color:#0000FF'|''"Your skin feels webby."'' | |style='color:#0000FF'|''"Your skin feels webby."'' | ||
| | |Genetics | ||
| | |{{Positiveinstabilitymoderate}} | ||
|} | |||
==== [[Sects|Chaplain Religion]] exclusives ==== | |||
Mutations granted by some of the [[Chaplain]]'s [[Sects|religions]]. Their instability is set at 0. | |||
''"Less of a genome and more of a forceful rewrite of genes. Nothing Nanotrasen supplies allows for a genetic restructure like this..."'' | |||
{| class="wikitable sortable mw-collapsible mw-collapsed" border="1" cellspacing="0" cellpadding="2" | |||
! style='background-color:#3BB9FF;'|Name | |||
! style='background-color:#3BB9FF;'|Description | |||
! style='background-color:#3BB9FF;'|Message | |||
|- | |||
!Honorbound | |||
|''"The user feels compelled to follow supposed "rules of combat" but in reality they physically are unable to. Their brain is rewired to excuse any curious inabilities that arise from this odd effect."'' | |||
Disallows the subject to attack people unless they are attacked first. | |||
|style='color:#0000FF'|''"You feel honorbound!"'' | |||
|- | |||
!Burdened | |||
|''"The user feels compelled to injure themselves in various incapacitating and horrific ways. Oddly enough, this gene seems to be connected to several other ones, possibly ready to trigger more genetic changes in the future."'' | |||
Grants ''Telepathy'' and ''Mute'', then ''Telekinesis'' and ''Mind Reader'' as the subject becomes increasingly burdened through disabilities and debuffs (traumas, missing limbs and organs, addictions, mutations, ...). | |||
|style='color:#0000FF'|''"You feel burdened!"'' | |||
|} | |||
==== Admin-spawn only mutations ==== | |||
{| class="wikitable sortable mw-collapsible mw-collapsed" border="1" cellspacing="0" cellpadding="2" | |||
! style='background-color:#3BB9FF;'|Name | |||
! style='background-color:#3BB9FF;'|Description | |||
! style='background-color:#3BB9FF;'|Indicators | |||
! style='background-color:#3BB9FF;'|Message | |||
! style='background-color:#FF7F56;'|Instability | |||
|- | |- | ||
! | !X Ray Vision | ||
|A | |''"A strange genome that allows the user to see between the spaces of walls."'' | ||
|Subject | Subject gains the ability to see behind walls. Replaced by the [[Research_items#X-Ray_Implant|X-Ray implant]]. | ||
|style='color:# | |Subject's eyes ''glow eerily'' if looked at with a penlight. | ||
| | |style='color:#0000ff'|''"The walls suddenly disappear."'' | ||
|{{Positiveinstabilitymajor}} | |||
|- | |- | ||
! | !Laser Eyes | ||
| | |"Reflects concentrated light back from the eyes." | ||
|Subject | Subjects gains the ability to shoot laser beams from their eyes, dealing 25 burn damage. | ||
|style='color:# | |Subject's eyes glow in red. | ||
| | |style='color:#0000ff'|''"You feel pressure building up behind your eyes."'' | ||
|0 | |||
|- | |- | ||
!Unstable DNA | |||
|''"Strange mutation that causes the holder to randomly mutate."'' | |||
|Subject periodically mutates. | |||
|style='color:#ff0000'|''"You feel strange."'' | |||
|{{Negativestabilitymajor}} | |||
|} | |} | ||
Line 502: | Line 693: | ||
* Check the '''console''' next to it, you'll see a bunch of options. Find ''Genetic Sequencer''. | * Check the '''console''' next to it, you'll see a bunch of options. Find ''Genetic Sequencer''. | ||
All mutations are randomized every round. | All mutations are randomized every round. | ||
==== Humanizing a Monkey ==== | ==== Humanizing a Monkey ==== | ||
Always humanize your monkey first, or their powers wont work or be savable.''' | Always humanize your monkey first, or their powers wont work or be savable.''' | ||
# You and your geneticist buddy automatically share the mutations you've discovered, so work | # You and your geneticist buddy automatically share the mutations you've discovered, so work together to discover them all. Saved mutations have to be manually shared between computers using DNA Data Disks. | ||
# Click through the mutations and find | # Click through the mutations and find ''Monkified''. Then break a random pair by changing a letter to X with CTRL+Left Click. | ||
# When you've done it, you'll see the name on the top has changed from "monkey" to a randomly generated name. Congratulations, you've got your very own monkey-person! | # When you've done it, you'll see the name on the top has changed from "monkey" to a randomly generated name. Congratulations, you've got your very own monkey-person! | ||
# If for any reason you got yourself some bad mutations and have no one to remove them, grab the [[Guide_to_chemistry#Mutadone|mutadone]] pill bottle in your lab. You usually have several 50u pills available, which is overkill. Dissolve a pill by pouring a tiny amount of water into a beaker (by using the beaker on a sink once), then drop a pill of [[Guide_to_chemistry#Mutadone|mutadone]] into it and take a sip. It should instantly clear all your mutations. | |||
# If for any reason you got yourself some bad mutations and have no one to remove them, grab the [[Guide_to_chemistry#Mutadone|mutadone]] pill bottle in your lab. You usually have several 50u pills available, which is overkill. Dissolve a pill by pouring a tiny amount of water into a beaker (by using the beaker on a sink once), then drop a pill of [[Guide_to_chemistry#Mutadone|mutadone]] into it and take a sip. It should instantly clear all your mutations, | # [[Guide_to_chemistry#Mutadone|Mutadone]] will also clear the ''monkified'' mutation from monkeys, instantly turning them human. Use a dropper set to 1u to squirt the dissolved [[Guide_to_chemistry#Mutadone|mutadone]] into the eyes of monkeys to mass humanize them without needing any machinery. This will not make you "discover" the monkified mutation however. | ||
==== Manifesting Mutations ==== | ==== Manifesting Mutations ==== | ||
Line 516: | Line 707: | ||
# Find a mutation that has broken pairs. | # Find a mutation that has broken pairs. | ||
# Start filling in the X's. This is fairly easy since most of them are connected to an A, T, G | # Start filling in the X's. This is fairly easy since most of them are connected to an A, T, C or G. So X-T would be A-T. | ||
#* The left click increments from A to G (A>T>C>G>A) — the right click, the other way around. | |||
# You will often find X-X pairs. Make sure the rest is fixed first and then guess it. There's 4 possibilities. AT, TA, GC and CG. | # You will often find X-X pairs. Make sure the rest is fixed first and then guess it. There's 4 possibilities. AT, TA, GC and CG. | ||
# If there's more than 2 double X-pairs, consider using the JOKER option when editing a letter, which finds the correct letter for you (on a long | # If there's more than 2 double X-pairs, consider using the Genetic Scanner (as described [[#Genetic_Sequence_Scanner|above]]) by scanning the other monkeys, yourself, or random crew members, or the JOKER option when editing a letter, which finds the correct letter for you (on a very long cooldown—''20 minutes'' on unupgraded scanners). | ||
# If completing all pairs didn't work, you may have messed up somewhere. Double check. Also make sure they're not still a monkey. If all else fails, move on to another mutation or [[#Scramble DNA|scramble]] their DNA. | # If completing all pairs didn't work, you may have messed up somewhere. Double check. Also make sure they're not still a monkey. If all else fails, move on to another mutation or [[#Scramble DNA|scramble]] their DNA. | ||
==== Scramble DNA ==== | ==== Scramble DNA ==== | ||
Clicking the Scramble DNA | Clicking the Scramble DNA button will blast the subject's DNA with damaging genetic pulses, and randomize which discoverable mutations it has. This also inflicts a large amount of genetic damage at once. | ||
{{Anchor|Activators_and_Injectors}} <!-- Former name --> | |||
==== [[File:DNA Injector.png|64px]] Activators and Mutators ==== | |||
After manifesting a mutation in the [[#Genetic_Sequencer|Genetic Sequencer]] tab, hit ''store'' to save it to the "Storage - Mutations" tab. You can print activators and mutators from both the Sequencer and the Storage - Mutations tab. | |||
*'''Activators:''' An activator will permanently activate specific mutation in a person who already has mutation dormant as shown with a [[#Genetic_Sequence_Scanner|Genetic Sequence Scanner]] [[File:Gene_scanner.gif]]. For example, since all humans have the ''monkified'' mutation dormant in them, a ''monkified'' activator will always work on humans. Using an activator will not increase [[#Genetic_Instability|genetic instability]]. Used activators can be recycled into the DNA scanner access console to produce [[#Chromosome_21|chromosomes]]. | |||
*'''Mutators:''' A mutator will manifest a mutation in a person, regardless of if that person has that mutation dormant or not. This will inflict the mutation's [[#Genetic_Instability|instability]] (causes several bad effects if it reaches 100%). The mutation and its instability may then be removed by taking [[Guide_to_chemistry#Mutadone|Mutadone]]. | |||
*'''Activators:''' An activator will permanently activate specific mutation in a person who already has mutation dormant as shown with a [[#Genetic_Sequence_Scanner|Genetic Sequence Scanner]] [[File:Gene_scanner.gif]]. For example, since all humans have the | |||
*''' | |||
<br> | <br> | ||
The DNA Scanner Access Console takes time to recharge after producing an activator or | The DNA Scanner Access Console takes time to recharge after producing an activator or mutators. Activators have a much shorter cooldown. | ||
==== [[File:DNA Injector.png|64px]] Advanced Injectors ==== | ==== [[File:DNA Injector.png|64px]] Advanced Injectors ==== | ||
[[File:Time-Green_advanced_injectors_first_screenshot.png|thumb|200px|right|This is the "Adv. Injectors" tab. ]] | [[File:Time-Green_advanced_injectors_first_screenshot.png|thumb|200px|right|This is the "Adv. Injectors" tab. ]] | ||
After discovering one or more mutations, you have the option to create advanced injectors. Advanced injectors will let you save multiple mutations in a single injector. The amount of mutations in a single "save" is limited to 50 instability or 10 mutations. Unlike activators or ordinary | After discovering one or more mutations, you have the option to create advanced injectors. Advanced injectors will let you save multiple mutations in a single injector. The amount of mutations in a single "save" is limited to 50 [[#Genetic_Instability|instability]] or 10 mutations. Unlike activators or ordinary mutators, these can be named anything you want. To create an advanced injector, do the following: | ||
#Go to the "Adv. Injectors" tab. Click " | #Go to either the "Storage - Adv. Injectors" tab. Click "Create new injector" and choose a name to crate a new slot for mutations to be stored in. | ||
#Go to the [[#Genetic_Sequencer| | #Go to the [[#Genetic_Sequencer|Sequencer]] tab or the "Storage - Mutations" tab and click on a stored or discovered and active mutation. | ||
#Click " | #Click "Add to advanced injector". Select the name of the slot you made in step 1. Repeat with any other mutations you wish to save to the same advanced injector. | ||
#Go back to the "Adv. Injectors". Click ''Print | #Go back to the "Adv. Injectors". Click ''Print''. You will print an injector with named "Advanced (name) injector". | ||
==== Genetic Instability ==== | ==== Genetic Instability ==== | ||
When you manifest a power, you may get a message like "It feels like your skin is moving." This is telling you that your genetic instability has gotten higher, and you'll need to be careful not to add too many more powers. All humans can withstand up to '''99 genetic instability''' before they start to bubble and melt. 100 instability would be too much. What happens when you suffer from a genetic | When you manifest a power, you may get a message like "It feels like your skin is moving." This is telling you that your genetic instability has gotten higher, and you'll need to be careful not to add too many more powers. All humans can withstand up to '''99 genetic instability''' before they start to bubble and melt. 100 instability would be too much. What happens when you suffer from a genetic breakdown is random and unpredictable, and draws from one of two lists of effects, ranging from 'Mostly Harmless' to 'Dead and Unrevivable'. Negative mutations generally don't give you instability, but powers do. As a rule of thumb, the stronger the power, the more instability it gives. Choose your powers wisely. | ||
==== Chromosome 21 ==== | ==== Chromosome 21 ==== | ||
Every time you successfully use an ACTIVATOR on another person, the activator becomes filled with genetic data. Recycle/use it on your DNA console to gain a random chromosome | Every time you successfully use an ACTIVATOR on another person, the activator becomes filled with genetic data. Recycle/use it on your DNA console for a 60% chance to gain a random chromosome. The chromosome gets stored in the "Storage - Chromosomes" tab. Clicking on a chromosome gives you information about it. You can also eject it into its physical form. Physical chromosomes can only be used by inserting them into a DNA console. <br><br> | ||
Each active mutation in a person has a single chromosome slot. You can only add chromosomes to people who are inside the connected DNA scanner. Do so by opening the '' | Each active mutation in a person has a single chromosome slot. You can only add chromosomes to people who are inside the connected DNA scanner. Do so by opening the ''Sequencer'' tab. Then click an activated mutation, or [[#Manifesting_Mutations|find one]] if none is active yet. You should see the line ''Select a chromosome'' followed by a list of chromosomes that mutation would be compatible with. Select a chromosome in the dropdown menu and you have now filled that mutation's chromosome slot. To delete the chromosome from a mutation you need to deactivate and reactivate the mutation by changing any letter and then back. <br> | ||
After you have added a chromosome to a mutation, you can ''store'' it to the ''mutations'' tab as normal (by clicking '' | After you have added a chromosome to a mutation, you can ''store'' it to the ''Storage - mutations'' tab as normal (by clicking ''Save to console'' in the ''Sequencer'' tab). Mutations from mutators/activators printed from this stored entry will then contain that chromosome. The stored entry will retain its applied chromosome if saved to a Genetics data disk and transferred to a different DNA Scanner console. | ||
These are the currently available chromosomes you can get (the chance for a chromosome to be of a specific type is listed next to that type in parenthesis): | These are the currently available chromosomes you can get (the chance for a chromosome to be of a specific type is listed next to that type in parenthesis): | ||
* '''Synchronizer''' (5/ | * '''Synchronizer''' (5/16): Gives the mind more control over the mutation, reducing some downsides by 50%. | ||
* '''Stabilizer''' (1/ | * '''Stabilizer''' (1/16): The rarest chromosome. Reduces [[#Genetic_Instability|instability]] gained from the mutation by 20%. | ||
* '''Power''' (5/ | * '''Power''' (5/16): Boosts strength of certain mutations. Experiment with super sneeze or even deadlier fireballs! | ||
* '''Energetic''' (5/ | * '''Energetic''' (5/16): Reduces cooldown on action based mutations. | ||
* '''Reinforcement''' (3/19): Makes the mutation immune to mutadone. | * <s>'''Reinforcement''' (3/19): Makes the mutation immune to mutadone.</s> Removed Aug 2020. | ||
Chromosomes aren't supposed to be addable to mutations that won't benefit from them. For example, you can't use the energetic chromosome on the monkey mutation. | Chromosomes aren't supposed to be addable to mutations that won't benefit from them. For example, you can't use the energetic chromosome on the monkey mutation. | ||
=== What to do with your powers === | |||
* Export your best powers to a disk, as a backup. There's always the risk of an [[AI]] or someone else deleting them for any reason. | * Export your best powers to a disk, as a backup. There's always the risk of an [[AI]] or someone else deleting them for any reason. | ||
* Make injectors to give to <s>the greytide</s>heads of staff or | * Make injectors to give to <s>[[Assistant|the greytide]]</s> the [[Chain_of_Command#Heads_of_Staff|heads of staff]], the [[Security|security]], or the [[Engineer|Engineers]]. You can also sell them for money! | ||
* Because injectors exist, geneticists may often be asked for powers by randoms. Use your best judgement to decide who gets powers and not, because nothing gets the station down like a herd of assistants with Hulk. Be ready to say "no" a lot. You are allowed to have powers, but if you run around the station while being a hulk don't go on a killing/destroying rampage as that's a bannable offense. | * Because injectors exist, geneticists may often be asked for powers by randoms. Use your best judgement to decide who gets powers and not, because nothing gets the station down like a herd of assistants with Hulk. Be ready to say "no" a lot. You are allowed to have powers, but if you run around the station while being a hulk don't go on a killing/destroying rampage as that's a bannable offense. | ||
* Enjoy being the peak of human evolution! Use your powers for the greater good, or to make security's life hell by breaking down walls to high security areas and by being unstunnable. Remember that hulks are nonhuman to the AI, though, and when security can't stun someone they'll take out their lethals. | * Enjoy being the peak of human evolution! Use your powers for the greater good, or to make security's life hell by breaking down walls to high security areas and by being unstunnable. Remember that hulks are nonhuman to the AI, though, and when security can't stun someone they'll take out their lethals. | ||
=== | === Healing your subjects and yourself === | ||
During your experiments, your subjects are likely to get hurt, whether from banging their heads on the tube, or negative mutations—most notably ''H.A.R.S.'' and ''Radioactive''. If unlucky, you may also be hurt. For that, there are several solutions: | |||
* The [[Roboticist]] can build [[Guide_to_robotics#Medibot|medibots]]. The white ones will heal blunt damage, but there also are the green and yellow versions, able to heal tox/rads and burn damage, respectively. | |||
* The [[Chemist|Chemists]] can provide you specific medicines, including [[Guide_to_chemistry#Potassium_Iodide|Potassium Iodide]] for radiations (and toxins in irradiated carbons), [[Guide_to_chemistry#Pentetic_Acid|Pentetic Acid]] for toxins and rads, and several others for burns, brute, or whatever else you may need. | |||
Beware that Radioactive subjects may irradiate you and nearby items, so quickly remove that mutation once found. | |||
<br><br>Congratulations. If you read everything | === CRISPR Editing === | ||
This allows you to swap out base mutations in a targeted way. Base mutations don't suffer from [[#Genetic_Instability|instability]] | |||
==== Getting a CRISPR Charge ==== | |||
First, you'll need to collect a CRISPR charge. This is a sample of a virus with genetic abilities you can use to swap out base mutations. | |||
* Get the Viro to make a virus with either [[Infections#Symptoms_Table|Dormant DNA Activator]] or [[Infections#Symptoms_Table|Viral Evolutionary Acceleration]] (Ideally otherwise benign) | |||
* Have a containment protocol, get yourself scanned for diseases if you get symptoms, hope the cure is available if things go south | |||
* Infect a contained monkey, use an Activator (not a Mutator) on it - it collects the charge when it collects chromosomes | |||
* Feed the used activator to the console to add the charge to the console | |||
==== Using a CRISPR Charge ==== | |||
You'll need the top row of the sequence pairs of both the mutation you want to target and the mutation you want to replace it with. Here's the basic flow: | |||
* Solve the mutation you want or just use a mutator on a humanized monkey | |||
* Take note of the top row | |||
* On the subject you want to swap mutations on, solve the mutation you want to swap | |||
* Use a CRISPR charge on it | |||
* Feed in a special CRISPR string instructing the virus to replace that mutation with the desired mutation | |||
===== Building the CRISPR String ===== | |||
For example, let's say Epilepsy is | |||
* '''<code>A T T A C G C G A T T A C G C G</code>''' | |||
* '''<code>T A A T G C G C T A A T G C G C</code>''' | |||
And Telekinesis is | |||
* '''<code>A T A T C C G G A T T A C C G G</code>''' | |||
* '''<code>T A T A G G C C T A A T G G C C</code>''' | |||
Take note of the first row of both | |||
* Epilepsy is '''<code>A T T A C G C G A T T A C G C G</code>''' | |||
* Telekinesis is '''<code>A T A T C C G G A T T A C C G G</code>''' | |||
You then need to weave these rows together, old-new-old-new-old-new like this: | |||
* '''<code>_A T A T C C G G A T T A C C G G :NEW (Telekinesis)</code>''' | |||
* '''<code>AATTTAATCCGCCGGGAATTTTAACCGCCGGG :CRISPR String</code>''' | |||
* '''<code>A T T A C G C G A T T A C G C G_ :OLD (Epilepsy)</code>''' | |||
Now, when you use CRISPR on the solved base mutation you intend to swap, feed in that string! It swaps ''Epilepsy'' out for ''Telekinesis''. | |||
* '''<code> AATTTAATCCGCCGGGAATTTTAACCGCCGGG </code>''' | |||
If your string is not the right length, nothing happens, but if the string is wrong, you may end up with ''Acid Flesh'' instead, but scrambled and with no guides - hope you've got activators! Careful not to be wrong multiple times, lest you overwrite multiple mutations to the same one and need to shuffle to get them back. | |||
Also, the CRISPR charge, being a repurposed virus, might sometimes go rogue and infect you randomly. | |||
<br><br> Congratulations. If you read everything in this guide, you should now be a full-fledged Geneticist. | |||
==DNA Infusion == | |||
Just settling with regular-old mutations not enough? Feel a need to TRANSCEND your human form? Maybe a little too into those weird Japanese cartoons? The brand new DNA infuser located genetics lets you become part BEAST, through... science! All you have to do is stick a corpse of a viable (or not) animal in and a live test subject, and the machine will destroy the corpse to replace one of the test subject's organs with a brand new mutant set. Enough mutant organs from the same type will make you a proper mutant of that type, possibly changing your species or conveying other positive or negative effects! | |||
{| class="wikitable" | |||
|+ | |||
!Mutant Type | |||
!Animals with Matching DNA | |||
!Possible Mutant Organs | |||
!Organs Required for Set Bonus | |||
!Set Bonus | |||
|- | |||
|Rejected | |||
|Any not listed here | |||
|Fly eyes, proboscis, fly heart, fly lungs,fly liver, fly stomach, fly appendix. | |||
|4 | |||
|Turns you into a fully fledged flyperson, like you can become from messing up teleportation. Why the hell would you want to do this? | |||
|- | |||
|Carp | |||
|Space carp | |||
|Carp lungs (Let you breathe in space but NOT on station), | |||
Carp jaws (Stronger bites and can drop carp teeth, but can't wear anything in mask slot), | |||
Carp brain (On a timer, gives you a negative moodlet advising you to 'go exploring', IE travel to a different Z-level), | |||
Carp heart. | |||
|4 | |||
|Allows you to move freely through space, like a carp can! | |||
|- | |||
|Rat | |||
|Rodents | |||
|Rat eyes (light sensitive but have night vision), | |||
rat stomach, rat heart, rat tongue. | |||
|4 | |||
|Gain the ability to crawl through station ventilation, as long as your clothes don't get in the way. | |||
|- | |||
|Goliath | |||
|Goliaths | |||
|Goliath eyes (night vision), | |||
goliath lungs (lets you breathe on lavaland but | |||
NOT on station), | |||
goliath brain (no gloves but one of your arms becomes a | |||
tendril hammer), | |||
goliath heart (makes you immune to ash storms.) | |||
|4 | |||
|Makes you immune to lava. | |||
|- | |||
|Cat | |||
|Cat | |||
|Cat ears, cat tail. | |||
|N/A | |||
|You're part cat now, just like in those cartoons with those girls you like so much. | |||
|- | |||
|Fox | |||
|Fox | |||
|Fox ears. | |||
|N/A | |||
|You have fox ears, just like that girl on that poster you keep on your wall. | |||
|} | |||
==[[File:scanner.gif|32px]][[File:Medcom.gif|32px]][[File:Clone.gif|32px]] Cloning == | |||
Cloning was removed from the game in Jan, 2020. This is only for historical reference. | |||
<div class="toccolours mw-collapsible mw-collapsed"> | |||
Expand for the old guide to cloning. | |||
<div class="mw-collapsible-content"> | |||
For a cloning process we need a dead body and cloning equipment, which can be found in your Cloning Room. | |||
# First of all, you have to know that for all things cloning, the [[Chief Medical Officer]] has a final say. He is your boss on this side of Genetics. If he tells you to clone someone and not some other guy, you do it. The only person with higher say than him on these matters is the Captain. | |||
# On to the specifics! How to clone: Just '''grab or pull''' a body and stuff it '''into the [[DNA Scanner]] and close the door'''. If you want to remove someone from a Scanner, click on it to open the door. Unless the Scanner is locked, the person/monkey inside is going to pop right out. [[File:Cloning_console_scan_successful.png|thumb|200px|right|This is the cloning console menu.]] | |||
# When the Scanner is occupied, '''interact with the Cloning Console'''. You will see a few options. The most important one is "scan". Click it. If they can be cloned, scanning will succeed regardless of whether they're in their body or not. There are several possible errors that can happen when you try to scan. See the [[#Cloning_Error|section about cloning errors]] for details. | |||
# If scanning is successful, you will get a '''''Successful Scan'' -message'''. That means you now have that person's cloning data saved. You can use this record to steal their genetic data at any time, but cloning is more limited - if their last death happened after they got scanned, any attempts to clone using the scanned record will fail. [[File:Cloning_console_view_records.png|thumb|200px|right|This is what you see after clicking "View Records".]] | |||
# After you actually have DNA data from a person, '''click Check Records''', and then '''click View Record''' of the person who you want to clone. You will see a list of their [[#Unique_Identifiers|UI]](Unique Identifiers) and their [[#Structural_Enzymes|SEs]] (Structural Enzymes). These can be copied and pasted with a cloning data disk (see one of the images to the right). '''Click Clone'''. You will notice that the Cloning Pod is now fully active, with a shadow inside. That is the new body. You can now '''take the old corpse out of the DNA Scanner''', '''strip it completely''' so the cloned person can have their stuff back, and '''place the old corpse inside a body bag in the morgue'''. You don't have to worry about the old corpse anymore. [[File:Cloning_console_view_record_with_disk.png|thumb|200px|right|This is what can you see after clicking a specific "View Record" under "View Records". If you have an ID with cloning access you can delete a record. Otherwise it will say "access denied" when trying to delete it. If you have inserted a "cloning data disk" you have additional options to save or load [[#Unique_Enzymes|UE]], [[#Unique_Identifiers|UI]] and [[#Structural_Enzymes|SE]] (dormant mutations) to and from that disk.]] | |||
# The cloning process takes about 2 or 3 minutes depending on upgrades. For whoever is getting cloned, it may feel like a very long time. While the person is getting their new body formed, take their '''belongings and stuff them all into a locker''', so they're not scattered all over or stolen. Cloning the captain and leaving their ID or other secure items on the floor is bad. | |||
#* '''Aborted cloning:''' Use this as [[traitor]] to screw with that assistant who talked smack to you earlier. During the cloning process, it is possible to eject the incomplete clone by unlocking the Cloning Pod with your ID and ejecting the unfinished clone (needs to be >40% done) or by getting an Engineer to unlock the Genetics APC so you can shut off the power temporarily, which also causes the clone to (instantly, no matter how done) eject. This will usually clone people without limbs or vital organs, making them die quickly. | |||
# The cloned people often have cellular damage. If so, take them to cryo to fix it. | |||
# After the pod is empty, feel free to '''clone your next patient''', and to let the old one out, since they most likely don't have clearance to open the door. | |||
# If R&D has been doing their job, they might upgrade the cloner to a level where it can '''autoprocess'''. If this is the case, you only have to press the Autoprocess button on top of the window, and the cloner will scan and clone automatically. This is useful to process a large pile of bodies quickly. Scan them one at a time, and autoprocess will do the rest. | |||
=== [[File:Husk.png|64px|OH GOD OH FUCK]] Hark! A Husk! === | |||
So you've come across a [[husk]] (a grey corpse) on your floor, which means you can't clone that poor sod without upgrades. Before you go throwing that body in the morgue, they can still be helped! | |||
# First off, make sure it's a husk. Throw the body into a DNA Scanner, if it says ''Subject no longer contains the fundamental materials required to create a living clone'', then you have yourself a husk (if your DNA Scanner had been [[Guide_to_advanced_construction#DNA_Scanner|updated]] to the max by the Scientists, you could clone the husk right now. So if you know they've been doing their R&D, ask them). | |||
# Take the body down to [[Surgery]]. | |||
# Pester the CMO or a Medical Doctor to extract the brain, or do it yourself. | |||
# Put the brain in the DNA scanner like you would a body. | |||
Optionally a husk can be unhusked with [[Guide_to_chemistry#Rezadone|rezadone]]. If all goes well then your cadaver will be reborn. <br> | |||
====Changeling Victims==== | |||
If examining the husk shows "He/she is limp and unresponsive; there are no signs of life... " it means the body has a soul online. If the corpse still can't be scanned in fully upgraded cloning, it's possible it was someone who got absorbed by a [[Changeling|changeling]]. There appears to be no easy way to revive absorbed victims. Not even through brain transplants. | |||
=== Helping the Headless === | |||
Sometimes you'll find a corpse whose head is separated from their body. Thanks to the marvels of modern science, this is not a problem! | |||
#If you have a head or a brain, just chuck it into the cloner as normal. This may require the DNA scanner to be upgraded though. To clone a head or brain you must throw it into the DNA Scanner by activating throw with '''R''' and then clicking it, or by walking into the DNA scanner and dropping the head/brain. Then click the cloner to close it. | |||
#If you don't have the head, but you have the body, not all hope is lost: take a blood sample and give it to the botanist to make a replica pod, and the deceased guy will be reborn as a podperson! | |||
#If you have neither, he's dead for good. | |||
===Cloning Plasmamen=== | |||
If the patient is a [[plasmaman]], cloning them will be complicated by the fact that the naked patient will burn in the station's atmosphere. This can be dealt with by using showers to keep the patient from catching fire, then dressing them in a plasma envirosuit. | |||
# Put plasmaman into cloning scanner | |||
# Scan them, start the cloning process | |||
# Drag their dead body to cloning pod | |||
# Undress them and leave their clothes in a pile | |||
# Turn on shower near cloning pod | |||
# Once they pop out of cloner, put them under shower and wait for them to dress up | |||
If the patient is a naked or beheaded plasmaman, follow these additional steps: | |||
# Once they pop out of cloner, put them under shower and feed them a few [[Guide_to_chemistry#Salbutamol|Salbutamol]] pills (if available), or if desperate, keep a syringe of [[Guide_to_chemistry#Perfluorodecalin|Perfluorodecalin]] ready in case you need it. Plasmamen suffocate if they don't have plasma to breathe! | |||
# Yell at [[Supply_crates|cargo]] to order plasmaman supplies. In the meantime, bug Engineering/Atmos for a filled plasma tank. | |||
===Empty Cloning=== | |||
Cloners have the option to "Empty Clone" a record, creating a mindless replica of a person. To complement this function, cloners can do Body-Only scans, which can only be used to create empty clones but not real clones, and bypass the sentience restrictions that ordinary scans have. These body-only entries can be deleted without requiring access. | |||
=== Cloning Errors === | |||
{| class="wikitable" | |||
|- | |||
! Error message | |||
! Cause | |||
! Solution | |||
|- | |||
| Unable to locate valid genetic data. | |||
| Whatever you put inside the scanner doesn't have valid (humanoid) DNA. | |||
| Stop putting bees in the scanner. | |||
|- | |||
| Subject's brain is not responding to scanning stimuli. | |||
| The person inside has suicided or signed an infernal contract. Cloning is impossible. | |||
| Let the [[Cook]] take care of them or put the body in the morgue. | |||
|- | |||
| Subject no longer contains the fundamental materials required to create a living clone. | |||
| You're trying to scan a body that's been husked or smashed by megafauna, but your scanner doesn't have a (tri-)phasic scanning module. | |||
| Remove the brain and scan it. Yell at RnD to upgrade your scanner. | |||
|- | |||
| Mental interface failure. | |||
| The corpse has no ghost associated with it. | |||
| Try again in a few seconds - ghosts get notified when someone attempts to scan their body. No success? Let the [[Cook]] handle it. | |||
|- | |||
| Subject already in database. | |||
| That person has already been scanned. | |||
| Start the cloning process. Want to update the current clone scan? The CMO can delete scan files. | |||
|- | |||
| Initialisation failure. | |||
| The patient is still alive. | |||
| Try again when the patient is dead. | |||
|- | |||
| Unable to initiate cloning cycle. | |||
| Cloning has been disabled in the server config. | |||
| Yell at admins and hand the corpse over to the [[Chef]]. | |||
|- | |||
| Corpse has no head. | |||
| [[Changeling|Some asshole]] decapitated your guy - clone scanning is impossible without a brain. | |||
| Draw a blood sample and ask [[Botany]] to clone them with the Replica Pod plant. Can't draw blood either? Your patient is out of luck. | |||
|} | |||
Keep in mind that patching up a corpse with Synthflesh and then reviving it with Strange Reagent bypasses a lot of these issues. | |||
</div> | |||
</div> | |||
== The Gene Genie - The Traitorous Geneticist == | == The Gene Genie - The Traitorous Geneticist == | ||
Sorry for the bad chapter title. I wanted to use that for a very long time. | Sorry for the bad chapter title. I wanted to use that for a very long time. | ||
So, you learned how to do your job successfully, and how to be a credit to the station. You learned how to manipulate genes. Now you want to learn what the hell to do when the syndicate is the one writing your checks! Well, fret not! I will give you some pointers. But these are mostly tips - traitorous objectives differ wildly, and change your actions way too much for me to write a real guide on it. | So, you learned how to do your job successfully, and how to be a credit to the station. You learned how to manipulate genes. Now you want to learn what the hell to do when the syndicate is the one writing your checks! Well, fret not! I will give you some pointers. But these are mostly tips - traitorous objectives differ wildly, and change your actions way too much for me to write a real guide on it. | ||
=== | === [[Revolutionary]] === | ||
If you managed to kill a head of staff, copy their identity with a DNA scanner and apply it to yourself. Impersonating a head of staff during a revolution is useful since they are usually exempt from implanting. | If you managed to kill a head of staff, copy their identity with a DNA scanner and apply it to yourself. Impersonating a head of staff during a revolution is useful since they are usually exempt from implanting. | ||
=== Traitor === | === [[Traitor]] === | ||
Depends on your objective. If it's a hard one, like stealing the AI... well, you're fucked. Keep working on those powers! As soon as you have Hulk + TK, go for it as you wish. No tips here. | Depends on your objective. If it's a hard one, like stealing the AI... well, you're fucked. Keep working on those powers! As soon as you have Hulk + TK, go for it as you wish. No tips here. | ||
If your objective is a simple one, though, like stealing the hand tele, there are more approaches to this. As the above tip, you can just break the walls with TK Hulk, but that is rather crass. There's a more roundabout, but classier way to tackle this. Take a monkey from the pen, transform it in a human. Take its UI+UEs, make an injector, stuff it in your pocket with a label like "Clean Backup - Alexa White".<br/>Now get your own UI+UEs and name it "Clean Backup - Original" or something. Avoid using your name. Now, go hide somewhere close to the item's location, stick yourself with the monkey injector, spawn | If your objective is a simple one, though, like stealing the hand tele, there are more approaches to this. As the above tip, you can just break the walls with TK Hulk, but that is rather crass. There's a more roundabout, but classier way to tackle this. Take a monkey from the pen, transform it in a human. Take its UI+UEs, make an injector, stuff it in your pocket with a label like "Clean Backup - Alexa White".<br/>Now get your own UI+UEs and name it "Clean Backup - Original" or something. Avoid using your name. Now, go hide somewhere close to the item's location, stick yourself with the monkey injector, spawn doorjack, stick ID and PDA in your backpack. For added stealth, get a different outfit. doorjack your way to the captain's room, get his hand tele, RUN RUN RUN. The AI might see you, so it would also be good if you spawned an agent card so you can't be tracked. If anyone sees you, they're not going to see your actual name, only the humanized monkey's name. Hide, stick yourself with your own stuff, change clothes, walk away smoothly. | ||
If you have to kill someone, same stuff from rev. | If you have to kill someone, same stuff from rev. | ||
Also, never forget identity theft. Since you can take someone's complete identity, including looks, you can have some fun with that. | Also, never forget identity theft. Since you can take someone's complete identity, including looks, you can have some fun with that. | ||
=== [[Changeling]] === | |||
You can DNA sting humanized monkeys to quickly gather stored genomes. Similarly, once people start coming for mutations, you will have plenty of DNA to collect. | |||
=== Returning to Monke === | |||
If you're looking for combat or stealth bonuses, you may use ''Monkified'' to get the monkeys', as well as several useful mutations (e.g., ''Telekinesis'', ''Shock Touch'', ''Chameleon'', ''Gigantism'' and ''Dwarfism''). | |||
Monkeys have the ability to steal items from people's hands, ventcrawl, and several other benefits. The transformation is unexpensive and available extremely early in the round (unlike the [[Scientist|Xenobiologist's]] slime transformation). | |||
{{anchor | Guide_to_gorilla}} | |||
Alternatively, there are [[Critters#Gorilla|gorillas]]. Since the [https://github.com/tgstation/tgstation/pull/62265 radiation modernization changes (Oct, 2021)], you have a nearly-exclusive access to gorillas. You may transform monkeys into gorillas, including yourself, other crewmembers or antagonists. | |||
Given their status as a ''simplemob'', gorillas are immune to wounds and most chemicals—essentially the ''Hulk'''s weaknesses. They are additionally immune to stuns and shoves (like Hulks), viruses, and mutations. Unlike Hulks, they are unable to destroy reinforced walls. | |||
* Note that gorillas are thus also immune to the benefits of those, and to surgeries. Healing is going to be more complicated than for hulks, and someone may Lazarus their carcasses to assist against the other gorillas. | |||
The gorilla AI is extremely hostile, keeping aggro until their target is dead, and have a tendency to delimb corpses people that are unconscious (incl. hard crit). | |||
To transform a monkey into a gorilla, you have two options: | |||
* ''Genetic bombing:'' once above 2500 genetic damage, monkeys have a 25% chance per second to transform. | |||
* ''Mind-Magnification Helmets:'' when removing MM helmets, the sentient monkey has a slight chance (2.5%) to turn into an equally sentient gorilla. | |||
Additionally, the [[Traitor]] geneticist's uplink offers [[Syndicate_Items#Box_of_Gorilla_Cubes|Gorilla Cubes]] and [[Syndicate_Items#Magillitis_Serum_Autoinjector|an autoinjector]] turning them into a gorilla. | |||
[[Category:Guides]] | [[Category:Guides]] |
Latest revision as of 20:07, 25 May 2025
![]() |
This page needs revising!
The following page is out of date and/or needs to be revised. If the page's guide needs revision, see here for an example. |
![]() |
Ruth McVork says: "Welcome to Genetics, brother! Are you feeling good? You SHOULD feel good! You are now like unto a tiny god! Are you prepared to be what you were born to be? Are you ready to save the station (or totally fuck it up)? Chin up, buddy. It's not that hard. But before you start grabbing those monkeys from the pen, you should know the basics." |
The Department

Welcome to Genetics.
This room has two DNA Scanners and two DNA Scanner Access Consoles, along with some disk boxes and other supplies. The disks are extremely useful, as we will see later.
A nearby containment room holds your test subjects. These monkeys are going to be your guinea pigs. You are going to experiment on them, and make them suffer quite a bit. It's pretty inhumane. But such is life, and after a while it will all be worth it.

DNA Modification

.
Now, let's get you acquainted with the DNA Scanner Access Console. It has a few things of note. First you need to learn some terms:
Unique Enzymes
- Unique Enzymes (UE) = Your name. Even if you mutate the UE it will have no effect on the name. What you can do however, is to transfer UE from one person to another, copying their name.
Unique Identifiers
- Unique Identifiers (UI) = Your cosmetic details - eye color, skin color, hair style, hair color and gender.
In the DNA scanner access console there is a tab named "Enzymes". This tab can be used to copy UE and UI between people.
- Click "Save" to save a person's UE + UI to the console. You can not save mutations this way (anymore).
- Click "Transfer" to copy the genes of the buffer to whoever is inside the scanner. You can choose between Enzymes (UE), Identity (UI) and Full Makeup (UE+UI).
- Click "Transfer (Delayed)" to copy the genes of the buffer to the next person who steps into the scanner and closes it (such as yourself). This option is only available if the scanner is empty.
- Click "Print" to print a DNA injector containing the genes of the saved buffer. Injecting this into a person will transfer the UE, UI or UE+UI to that person. Unlike mutation injectors however, these DNA injectors are not permanent, and will only last for a short while after injected.
Structural Enzymes
- Structural Enzymes (SE) / Genetic Sequence = Your mutations. They contain data relevant to your genetic structure. This governs your race and mutations. The term "Structural Enzymes" is no longer used by the DNA scanner access console since it was replaced with "Genetic Sequence" (which is the same thing), but the term may still show up elsewhere.
Genetic Sequencer

In the DNA scanner access console there is a tab named "Sequencer". Here you will alter genes to find mutations. There are four types of blocks: A, T, C and G. Each pair of letters in the boxes are connected. A goes with T, and G goes with C. Order does not matter. Each pair has a correct combination of "AT, TG, CG or GC" that needs to be filled. If you see a an unmodified pair be X-T it means the right combination of that pair is A-T. When all 16 pairs have the right blocks, the mutation will activate and you will be able to store it. Monkeys can only have the monkified mutation unless humanized. Once you have found the name of a mutation, that mutation will be permanently identified in all DNA scanner access consoles.
You might want to disable the monkey mutation by replacing one of the healthy pairs with another letter. How to do all this will be detailed in the guide below.
Genetic Sequence Scanner

The more difficult mutations will have a lot of unknown (X-X) pairs. You cannot just randomly enter A-T, since it's predetermined what it's supposed to be. Knowing all this, you could whip out the genetic sequence scanner from your pocket. If you're looking for the correct pairs of mutation 39, scan people until you find a person with mutation 39. Then use the scanner in your hand for a menu to pop up. In the menu, select "mutation 39". This gives you a reading which will likely give you more information about which pairs you need to finish mutation 39.

You can use your Genetic Sequence Scanner on a DNA scanner access console to permanently synch the item, which makes you see the names of discovered mutations when scanning people with it.
More info about some of the other tabs can be found in the guide further below.
List of Mutations
Before we start splicing, you must know what possible monstrosities can be done to a human. Normally unobtainable mutations are highlighted in red text.
Mutation Name | Description | Indicators | Message | How/Where to Obtain | Instability |
---|---|---|---|---|---|
Adrenaline Rush | "Allows the host to trigger their body's adrenaline response at will." | \ | "You feel pumped up!" | Genetics | 25 |
Cold Adaptation | "A strange mutation that renders the host immune to damage from low temperature environments. It also prevents the host from slipping on ice."
This mutation is mutually exclusive with Heat, Thermal, and Pressure Adaptation. |
Subject has a pulsating blue "aura". | "Your body feels refreshingly cold." | Genetics | 25 |
Heat Adaptation | "A strange mutation that renders the host immune to damage from high temperature, including being set alight, though the flame itself still burns clothing. It also seems to make the host resist ash storms."
This mutation is mutually exclusive with Cold, Thermal, and Pressure Adaptation. |
Subject has a pulsating orange "aura". | "Your body feels invigoratingly warm." | Genetics | 25 |
Thermal Adaptation | "A strange mutation that renders the host immune to damage from both low and high temperature environments. Does not protect from high or low pressure environments."
This mutation is mutually exclusive with Cold, Heat, and Pressure Adaptation. |
Subject has a pulsating green "aura". | "Your body feels pleasantly room temperature." | Cold Adaptation + Heat Adaptation | 35 |
Pressure Adaptation | "A strange mutation that renders the host immune to damage from both low and high pressure environments. Does not protect from temperature, including the cold of space."
This mutation is mutually exclusive with Cold, Heat, and Thermal Adaptation. |
Subject has a pulsating pink "aura". | "Your body feels numb." | Genetics | 25 |
Antenna | "The affected person sprouts an antenna. This is known to allow them to access common radio channels passively." | Subject displays an antenna located on their head. | "You feel an antenna sprout from your forehead." | Genetics | 10 |
Mind Reader | "The affected person can look into the recent memories of others."
Subject displays the ability to read others' minds, learning their names and snippets of their past. Tin foil is known to block this. |
Subject displays an antenna located on their head. | "You hear distant voices at the corners of your mind." | Antenna + Paranoia / Punished God sect | 10 |
Autotomy | "Allows a creature to voluntary discard a random appendage." | \ | "Your joints feel loose." | Genetics | 10 |
Epilepsy | "A genetic defect that sporadically causes seizures."
Subject periodically falls down and starts shaking. |
Subject suffers from seizures. | "You get a headache." | Genetics | -30 |
Cough | "A chronic cough."
Subject periodically coughs, drop any items they're holding. Substantially harmless, but tends to get on the nerves of the subject. |
Subject coughs. | "You start coughing." | Genetics | -30 |
Paranoia | "Subject is easily terrified, and may suffer from hallucinations." | Subject screams frequently. | "You feel screams echo through your mind..." | Genetics | -30 |
Dwarfism | "A mutation believed to be the cause of dwarfism."
Subject turns into a manlet, making them unusually shorter than the rest of the crew. Dwarfs can pass over tables without stopping and are known to have less tolerance to mutations. This mutation is mutually exclusive with Acromegaly and Gigantism. |
Subject looks smaller. | "Everything around you seems to grow.." | Human Species | 10 |
Acromegaly | "A mutation believed to be the cause of acromegaly, or 'being unusually tall'."
Subject's legs and torso become more extensive. Not the same as Gigantism. This mutation is mutually exclusive with Dwarfism. |
Subject looks taller. | "You feel a small strange urge to fight small men with slingshots. Or maybe play some basketball." | Spacer Quirk | -30 |
Gigantism | "The cells within the subject spread out to cover more area, making them appear larger."
Subject shows increased tackling abilities, both offensive and defensive. Not the same as Acromegaly. This mutation is mutually exclusive with Dwarfism. |
Subject is slightly larger than normal. | "Everything around you seems to shrink.." | Genetics | 0 |
Clumsiness | "A genome that inhibits certain brain functions, causing the holder to appear clumsy. Honk!"
Subject displays clown-like clumsiness, accidentally dropping objects they hold, and being unable to use tasers, handcuffs, guns without them exploding back in their face. |
\ | "You feel lightheaded." | Genetics / Clowns | -40 |
Tourette's Syndrome | "A chronic twitch that forces the user to scream bad words."
Subject swears all the time and may also periodically experience paralysis. |
Subject curses out loudly and twitches. | "You twitch." | Genetics | 0 |
Deafness | "The holder of this genome is completely deaf." | \ | "You can't seem to hear anything..." | Genetics | -40 |
Monkified | "A strange genome, believing to be what differentiates monkeys from humans."
Subject transforms into a monkey. Innate mutation in humans and monkeys. |
Subject is a monkey. | "You feel unusually monkey-like." | Human and Monkey Species | -40 |
Glowy | "You permanently emit a light with a random color and intensity."
This mutation is mutually exclusive with Anti-Glow. |
Subject glows. | "Your skin begins to glow softly." | Genetics | 5 |
Anti-Glow | "Your skin seems to attract and absorb nearby light creating 'darkness' around you."
Subject absorbs light in a radius around it. Works on Ethereals and Luminescents. This mutation is mutually exclusive with Glow. |
Subject has an aura of darkness. | "The light around you seems to disappear." | Glowy + Void Magnet | 10 |
Strength | "The user's muscles slightly expand. Commonly seen in top-ranking boxers."
Subject displays better fitness and fishing skills, requiring less rest time. |
\ | "You feel stronger" | Genetics | 5 |
Stimmed | "The user's chemical balance is more robust. This mutation is known to slightly improve workout efficiency." | \ | "You feel stimmed." | Genetics | 5 |
Insulated | "The affected person does not conduct electricity." | \ | "Your fingertips go numb." | Genetics | 25 |
Fiery Sweat | "The user's skin will randomly combust, but is generally a lot more resilient to burning."
Subject's genetic stability decreases odds of combustion. This mutation is mutually exclusive with Heat Adaptation. |
Subject spontaneously combusts. | "You feel hot." | Genetics | 0 |
Spatial Instability | "The victim of the mutation has a very weak link to spatial reality, and may be displaced. Often causes extreme nausea." | Subject randomly teleports a short distance away. | "The space around you twists sickeningly." | Genetics | -30 |
Acidic Flesh | "Subject has acidic chemicals building up underneath the skin. This is often lethal."
Those buildups end up as acidic cutaneous eruptions, burning the subject. Acid-resistant clothes have been shown to protect the subject from these. |
Subject's skin frequently bubbles and pops, burning them. | "A horrible burning sensation envelops you as your flesh turns to acid!" | Genetics | -40 |
Spastic | "Subject suffers from muscle spasms."
Subject may unintentionnally hit nearby people and machinery, and harm themselves. |
Subject frequently spasms. | "You flinch." | Genetics | -30 |
Two Left Feet | "A mutation that replaces the right foot with another left foot. Symptoms include kissing the floor when taking a step." | Subject is randomly knocked down. | "Your right foot feels... left." | Genetics | -30 |
Internal Martyrdom | "A mutation that makes the body destruct when near death. Not damaging, but very, VERY disorienting."
Subject melts into gibs upon death. Harmful to witnesses' eyes and temporarily overloads Silicons. |
Subject explodes in a bloody shower when near death. | "You get an intense feeling of heartburn." | Strong + Stimmed | -40 |
H.A.R.S. | "A mutation that makes the body reject the head, the brain receding into the chest. Stands for Head Allergic Rejection Syndrome. Warning: Removing this mutation is very dangerous, though it will regenerate non-vital head organs." | Subject lacks a head. | "Something feels off." | Genetics | -40 |
Hypermetabolic Blood | "The subject's blood is hypermetabolic, causing it to be produced at a much faster rate." | \ | "You can feel your heartbeat pick up." | Genetics | 10 |
Rock Eater | "The subject's body is able to digest rocks and minerals."
This mutation is mutually exclusive with Rock Absorber. |
\ | "You feel a craving for rocks." | Genetics | 10 |
Rock Absorber | "The subject's body is able to digest rocks and minerals, taking on their properties."
This mutation is mutually exclusive with Rock Eater. |
\ | "You feel a supreme craving for rocks." | Rock Eater + Stoner | 35 |
Inexorable | "Your body can push on beyond the limits of normal human endurance. However, pushing it too far can cause severe damage to your body." | \ | "You feel inexorable." | Genetics | 25 |
Chameleon | "A genome that causes the holder's skin to become transparent over time."
Subject subtly alters light patterns to become invisible, as long as they remain still. |
Subject starts fading into the background. | "You feel one with your surroundings." | Genetic | 35 |
Geladikinesis | "Allows the user to concentrate moisture and sub-zero forces into snow." | \ | "Your hand feels cold." | Genetics | 10 |
Cryokinesis | "Draws negative energy from the sub-zero void to freeze surrounding temperatures at subject's will." | \ | "Your hand feels cold." | Genetics | 25 |
Farsight | "The subject's eyes are able to see further than normal." | \ | "You feel your eyes tingle." | Genetics | 10 |
Fire Breath | "An ancient mutation that gives lizards breath of fire." | \ | "Your throat is burning!" | Lizard Species | 25 |
Cindikinesis | "Allows the user to concentrate nearby heat into a pile of ash. Wow. Very interesting." | \ | "Your hand feels warm." | Geladikinesis + Fiery Sweat | 10 |
Pyrokinesis | "Draws positive energy from the surroundings to heat surrounding temperatures at subject's will." | \ | "Your hand feels hot!" | Cryokinesis + Fiery Sweat | 25 |
Hulk | "A poorly understood genome that causes the holder's muscles to expand, inhibit speech and gives the person a bad skin condition."
Subject becomes extremely strong, enough to punch through reinforced walls, and is unable to speak without yelling. Subject is also immune to stuns and slowdowns from stamina and normal damage, and cannot be pushed past. Breaking walls and machinery heavily damages to their arms. This mutation fades away when the subject falls in a critical state. Only works on human subjects.
This mutation is mutually exclusive with Ork. |
Subject turns green and has red eyes. | "Your muscles hurt." | Radioactive + Strength | 35 |
Ork | "A mutation caused by a mixup of hulk genes which severely impacts speech centers in owners' brains."
Works the same as Hulk but you may verbalize some words in Ork Language. This mutation is mutually exclusive with Hulk. |
Subject turns brown and has red eyes. | "You feel significantly dumber!" | Hulk + Clumsy | 35 |
Transcendent Olfaction | "Your sense of smell is comparable to that of a canine."
Subject displays the ability to track the scent of anyone who interacted with a certain object. |
\ | "Smells begin to make more sense..." | Genetics | 25 |
Biotech Compatibility | "Subject is more compatibile with biotechnology such as skillchips."
Subject displays tolerance to higher skillchip complexity capacity than average. |
\ | \ | Genetics | 10 |
Clever | "Causes the subject to feel just a little bit smarter. Most effective in specimens with low levels of intelligence."
Subject displays skills in advanced actions such as surgery and machinery interaction, despite low levels of intelligence. |
\ | "You feel a little bit smarter." | Genetics | 25 |
Radioactivity | "A volatile mutation that causes the host to sent out deadly beta radiation. This affects both the hosts and their surroundings." | Subject glows with a green aura | "You can feel it in your bones!" | Genetics | -40 |
Telekinesis | "A strange mutation that allows the holder to interact with objects through thought."
Subject can control objects with their mind, from far away! It is the most sought after power, since it allows for incredible deeds, and makes a strong robuster nearly immortal. To use it, switch to an empty hand and click on an object (note that, if they can, your character/the game will prioritize picking up an object normally over picking it up telekinetically). A circle symbol will appear underneath the object and in your hand and you can now control the object. Subject can also use any console from a distance. |
Appears as a blue glow around the subject's head. | "You feel smarter" | Genetics / Punished God sect | 35 |
Elastic Arms | "Subject's arms have become elastic, allowing them to stretch up to a meter away. However, this elasticity makes it difficult to wear gloves, handle complex tasks, or grab large objects."
Subject can grab objects and interact (help, attack, and grab) with mobs up to two tiles away unless there is a structure, like a table, or mob in the way. They cannot pull others around while using your elastic arms. Their fingers will become chunky, so you can't use guns, batons and computers. Subject also cannot wield items with both hands. |
\ | "You feel armstrong!" | Genetics | 35 |
Near Sightness | "The holder of this mutation has poor eyesight."
Subject displays difficulty to see objects far away. Perscription glasses are recommended. |
\ | "You can't see very well." | Genetics | -30 |
Blindness | "Renders the subject completely blind." | Subject's eyes don't react to penlight. | "You can't seem to see anything." | Genetics | -40 |
Thermal Vision | "The user of this genome can visually perceive the unique human thermal signature."
Subject can see people even through walls and in darkness for 10 seconds, for the cost of 10 eye damage. |
\ | "You can see the heat rising off of your skin..." | Genetics | 35 |
Illiterate | "Causes a severe case of Aphasia that prevents reading or writing."
Subject suffers from illiteracy, becoming unable to use paper, pens, computers, and electronics that require reading. |
\ | "You feel unable to read or write." | Genetics | -40 |
Nervousness | "Causes the holder to stutter." | Subject stammers when they speak. | "You feel nervous." | Genetics | 0 |
Wacky | "You are not a clown. You are the entire circus."
Subject speaks in an odd manner. |
\ | "You feel an off sensation in your voicebox." | Genetics | 0 |
Heckacious larincks | "duge what is WISH your words man..........."
Subject's language center is affected into forming sentences in a stoned manner. |
\ | "duge what is WISH your words man..........." | Wacky + Stoner | 0 |
Mute | "Completely inhibits the vocal section of the brain." | \ | "You feel unable to express yourself at all." | Genetics / Punished God sect | -40 |
Unintelligible | "Partially inhibits the vocal center of the brain, severely distorting speech."
Subject can only speak in short sentences. |
\ | "You can't seem to form any coherent thoughts!" | Genetics | -30 |
Swedish | "A horrible mutation originating from the distant past. Thought to be eradicated after the incident in 2037."
Subject's language center is affected into forming sentences in a vaguely norse manner. |
\ | "You feel Swedish, however that works." | Genetics | 0 |
Chav | "Unknown"
Subject's language center is affected into forming sentences in a more rudimentary manner. |
\ | "Ye feel like a reet prat like, innit?" | Genetics | 0 |
Elvis | "A terrifying mutation named after its 'patient-zero'."
Subject's language center is affected into forming sentences like the King of Rock and Roll. |
\ | "You feel pretty good, honeydoll." | Genetics | 0 |
Stoner | "A common mutation that severely decreases intelligence."
Subject's language center is affected into only being able to speak with other Beach folks. |
\ | "You feel...totally chill, man!" | Genetics / Beach Bum | 0 |
Medieval | "A horrible mutation originating from the distant past, thought to have once been a common gene in all of old world Europe."
Subject's language center is affected into forming sentences in a medieval manner. |
\ | "You feel like seeking the holy grail!." | Genetics | 0 |
Pig Latin | "Historians say back in the 2020's humanity spoke entirely in this mystical language."
Subject's language center is affected into forming sentences in an odd manner. |
\ | "Omethingsay eelsfay offyay." | Genetics | 0 |
Telepathy | "A rare mutation that allows the user to telepathically communicate to others." | \ | "You hear your thoughts echo in your mind" | Genetics / Punished God sect | 10 |
Tongue Spike | "Allows a creature to voluntary shoot their tongue out as a deadly weapon." | \ | "Your feel like you can throw your voice." | Genetics | 5 |
Chem Spike | "Allows a creature to voluntary shoot their tongue out as biomass, allowing a long range transfer of chemicals." | \ | "Your feel like you can really connect with people by throwing your voice." | Tongue Spike + Stimmed | 10 |
Shock Touch | "The affected can channel excess electricity through their hands without shocking themselves, allowing them to shock others. Mostly harmless! Mostly... " | \ | "You feel power flow through your hands." | Insulated + Radioactive | 25 |
Mending Touch | "The affected can lay their hands on other people to transfer a small amount of their injuries to themselves." | \ | "Your hand feels blessed!" | Genetics | 35 |
Void Magnet | "A rare genome that attracts odd forces not usually observed."
Subject's genetic stability decreases odds of anormality occurrence. Subject enters an immovable state of void-self against their will. |
Subject is periodically replaced with a hole in reality shaped like itself. | "You feel a heavy, dull force just beyond the walls watching you." | Genetics | 25 |
Webbing Production | "Allows the user to lay webbing, and travel through it." | Subject can navigate through webbing unaffected. | "Your skin feels webby." | Genetics | 25 |
Chaplain Religion exclusives
Mutations granted by some of the Chaplain's religions. Their instability is set at 0.
"Less of a genome and more of a forceful rewrite of genes. Nothing Nanotrasen supplies allows for a genetic restructure like this..."
Name | Description | Message |
---|---|---|
Honorbound | "The user feels compelled to follow supposed "rules of combat" but in reality they physically are unable to. Their brain is rewired to excuse any curious inabilities that arise from this odd effect."
Disallows the subject to attack people unless they are attacked first. |
"You feel honorbound!" |
Burdened | "The user feels compelled to injure themselves in various incapacitating and horrific ways. Oddly enough, this gene seems to be connected to several other ones, possibly ready to trigger more genetic changes in the future."
Grants Telepathy and Mute, then Telekinesis and Mind Reader as the subject becomes increasingly burdened through disabilities and debuffs (traumas, missing limbs and organs, addictions, mutations, ...). |
"You feel burdened!" |
Admin-spawn only mutations
Name | Description | Indicators | Message | Instability |
---|---|---|---|---|
X Ray Vision | "A strange genome that allows the user to see between the spaces of walls."
Subject gains the ability to see behind walls. Replaced by the X-Ray implant. |
Subject's eyes glow eerily if looked at with a penlight. | "The walls suddenly disappear." | 35 |
Laser Eyes | "Reflects concentrated light back from the eyes."
Subjects gains the ability to shoot laser beams from their eyes, dealing 25 burn damage. |
Subject's eyes glow in red. | "You feel pressure building up behind your eyes." | 0 |
Unstable DNA | "Strange mutation that causes the holder to randomly mutate." | Subject periodically mutates. | "You feel strange." | -40 |
Guide to finding and using mutations
This guide here shows you step by step how to find the powers from the mysterious blocks!
First Steps
This guide will start with using a monkey, because they're in the pen for a reason.
- Start by taking a monkey from the pen.
- Shove it into a DNA Scanner next to the pen, by click dragging.
- Check the console next to it, you'll see a bunch of options. Find Genetic Sequencer.
All mutations are randomized every round.
Humanizing a Monkey
Always humanize your monkey first, or their powers wont work or be savable.
- You and your geneticist buddy automatically share the mutations you've discovered, so work together to discover them all. Saved mutations have to be manually shared between computers using DNA Data Disks.
- Click through the mutations and find Monkified. Then break a random pair by changing a letter to X with CTRL+Left Click.
- When you've done it, you'll see the name on the top has changed from "monkey" to a randomly generated name. Congratulations, you've got your very own monkey-person!
- If for any reason you got yourself some bad mutations and have no one to remove them, grab the mutadone pill bottle in your lab. You usually have several 50u pills available, which is overkill. Dissolve a pill by pouring a tiny amount of water into a beaker (by using the beaker on a sink once), then drop a pill of mutadone into it and take a sip. It should instantly clear all your mutations.
- Mutadone will also clear the monkified mutation from monkeys, instantly turning them human. Use a dropper set to 1u to squirt the dissolved mutadone into the eyes of monkeys to mass humanize them without needing any machinery. This will not make you "discover" the monkified mutation however.
Manifesting Mutations
Back to business! Now we'll try to make a mutation show itself to us:
- Find a mutation that has broken pairs.
- Start filling in the X's. This is fairly easy since most of them are connected to an A, T, C or G. So X-T would be A-T.
- The left click increments from A to G (A>T>C>G>A) — the right click, the other way around.
- You will often find X-X pairs. Make sure the rest is fixed first and then guess it. There's 4 possibilities. AT, TA, GC and CG.
- If there's more than 2 double X-pairs, consider using the Genetic Scanner (as described above) by scanning the other monkeys, yourself, or random crew members, or the JOKER option when editing a letter, which finds the correct letter for you (on a very long cooldown—20 minutes on unupgraded scanners).
- If completing all pairs didn't work, you may have messed up somewhere. Double check. Also make sure they're not still a monkey. If all else fails, move on to another mutation or scramble their DNA.
Scramble DNA
Clicking the Scramble DNA button will blast the subject's DNA with damaging genetic pulses, and randomize which discoverable mutations it has. This also inflicts a large amount of genetic damage at once.
Activators and Mutators
After manifesting a mutation in the Genetic Sequencer tab, hit store to save it to the "Storage - Mutations" tab. You can print activators and mutators from both the Sequencer and the Storage - Mutations tab.
- Activators: An activator will permanently activate specific mutation in a person who already has mutation dormant as shown with a Genetic Sequence Scanner
. For example, since all humans have the monkified mutation dormant in them, a monkified activator will always work on humans. Using an activator will not increase genetic instability. Used activators can be recycled into the DNA scanner access console to produce chromosomes.
- Mutators: A mutator will manifest a mutation in a person, regardless of if that person has that mutation dormant or not. This will inflict the mutation's instability (causes several bad effects if it reaches 100%). The mutation and its instability may then be removed by taking Mutadone.
The DNA Scanner Access Console takes time to recharge after producing an activator or mutators. Activators have a much shorter cooldown.
Advanced Injectors

After discovering one or more mutations, you have the option to create advanced injectors. Advanced injectors will let you save multiple mutations in a single injector. The amount of mutations in a single "save" is limited to 50 instability or 10 mutations. Unlike activators or ordinary mutators, these can be named anything you want. To create an advanced injector, do the following:
- Go to either the "Storage - Adv. Injectors" tab. Click "Create new injector" and choose a name to crate a new slot for mutations to be stored in.
- Go to the Sequencer tab or the "Storage - Mutations" tab and click on a stored or discovered and active mutation.
- Click "Add to advanced injector". Select the name of the slot you made in step 1. Repeat with any other mutations you wish to save to the same advanced injector.
- Go back to the "Adv. Injectors". Click Print. You will print an injector with named "Advanced (name) injector".
Genetic Instability
When you manifest a power, you may get a message like "It feels like your skin is moving." This is telling you that your genetic instability has gotten higher, and you'll need to be careful not to add too many more powers. All humans can withstand up to 99 genetic instability before they start to bubble and melt. 100 instability would be too much. What happens when you suffer from a genetic breakdown is random and unpredictable, and draws from one of two lists of effects, ranging from 'Mostly Harmless' to 'Dead and Unrevivable'. Negative mutations generally don't give you instability, but powers do. As a rule of thumb, the stronger the power, the more instability it gives. Choose your powers wisely.
Chromosome 21
Every time you successfully use an ACTIVATOR on another person, the activator becomes filled with genetic data. Recycle/use it on your DNA console for a 60% chance to gain a random chromosome. The chromosome gets stored in the "Storage - Chromosomes" tab. Clicking on a chromosome gives you information about it. You can also eject it into its physical form. Physical chromosomes can only be used by inserting them into a DNA console.
Each active mutation in a person has a single chromosome slot. You can only add chromosomes to people who are inside the connected DNA scanner. Do so by opening the Sequencer tab. Then click an activated mutation, or find one if none is active yet. You should see the line Select a chromosome followed by a list of chromosomes that mutation would be compatible with. Select a chromosome in the dropdown menu and you have now filled that mutation's chromosome slot. To delete the chromosome from a mutation you need to deactivate and reactivate the mutation by changing any letter and then back.
After you have added a chromosome to a mutation, you can store it to the Storage - mutations tab as normal (by clicking Save to console in the Sequencer tab). Mutations from mutators/activators printed from this stored entry will then contain that chromosome. The stored entry will retain its applied chromosome if saved to a Genetics data disk and transferred to a different DNA Scanner console.
These are the currently available chromosomes you can get (the chance for a chromosome to be of a specific type is listed next to that type in parenthesis):
- Synchronizer (5/16): Gives the mind more control over the mutation, reducing some downsides by 50%.
- Stabilizer (1/16): The rarest chromosome. Reduces instability gained from the mutation by 20%.
- Power (5/16): Boosts strength of certain mutations. Experiment with super sneeze or even deadlier fireballs!
- Energetic (5/16): Reduces cooldown on action based mutations.
Reinforcement (3/19): Makes the mutation immune to mutadone.Removed Aug 2020.
Chromosomes aren't supposed to be addable to mutations that won't benefit from them. For example, you can't use the energetic chromosome on the monkey mutation.
What to do with your powers
- Export your best powers to a disk, as a backup. There's always the risk of an AI or someone else deleting them for any reason.
- Make injectors to give to
the greytidethe heads of staff, the security, or the Engineers. You can also sell them for money! - Because injectors exist, geneticists may often be asked for powers by randoms. Use your best judgement to decide who gets powers and not, because nothing gets the station down like a herd of assistants with Hulk. Be ready to say "no" a lot. You are allowed to have powers, but if you run around the station while being a hulk don't go on a killing/destroying rampage as that's a bannable offense.
- Enjoy being the peak of human evolution! Use your powers for the greater good, or to make security's life hell by breaking down walls to high security areas and by being unstunnable. Remember that hulks are nonhuman to the AI, though, and when security can't stun someone they'll take out their lethals.
Healing your subjects and yourself
During your experiments, your subjects are likely to get hurt, whether from banging their heads on the tube, or negative mutations—most notably H.A.R.S. and Radioactive. If unlucky, you may also be hurt. For that, there are several solutions:
- The Roboticist can build medibots. The white ones will heal blunt damage, but there also are the green and yellow versions, able to heal tox/rads and burn damage, respectively.
- The Chemists can provide you specific medicines, including Potassium Iodide for radiations (and toxins in irradiated carbons), Pentetic Acid for toxins and rads, and several others for burns, brute, or whatever else you may need.
Beware that Radioactive subjects may irradiate you and nearby items, so quickly remove that mutation once found.
CRISPR Editing
This allows you to swap out base mutations in a targeted way. Base mutations don't suffer from instability
Getting a CRISPR Charge
First, you'll need to collect a CRISPR charge. This is a sample of a virus with genetic abilities you can use to swap out base mutations.
- Get the Viro to make a virus with either Dormant DNA Activator or Viral Evolutionary Acceleration (Ideally otherwise benign)
- Have a containment protocol, get yourself scanned for diseases if you get symptoms, hope the cure is available if things go south
- Infect a contained monkey, use an Activator (not a Mutator) on it - it collects the charge when it collects chromosomes
- Feed the used activator to the console to add the charge to the console
Using a CRISPR Charge
You'll need the top row of the sequence pairs of both the mutation you want to target and the mutation you want to replace it with. Here's the basic flow:
- Solve the mutation you want or just use a mutator on a humanized monkey
- Take note of the top row
- On the subject you want to swap mutations on, solve the mutation you want to swap
- Use a CRISPR charge on it
- Feed in a special CRISPR string instructing the virus to replace that mutation with the desired mutation
Building the CRISPR String
For example, let's say Epilepsy is
A T T A C G C G A T T A C G C G
T A A T G C G C T A A T G C G C
And Telekinesis is
A T A T C C G G A T T A C C G G
T A T A G G C C T A A T G G C C
Take note of the first row of both
- Epilepsy is
A T T A C G C G A T T A C G C G
- Telekinesis is
A T A T C C G G A T T A C C G G
You then need to weave these rows together, old-new-old-new-old-new like this:
_A T A T C C G G A T T A C C G G :NEW (Telekinesis)
AATTTAATCCGCCGGGAATTTTAACCGCCGGG :CRISPR String
A T T A C G C G A T T A C G C G_ :OLD (Epilepsy)
Now, when you use CRISPR on the solved base mutation you intend to swap, feed in that string! It swaps Epilepsy out for Telekinesis.
AATTTAATCCGCCGGGAATTTTAACCGCCGGG
If your string is not the right length, nothing happens, but if the string is wrong, you may end up with Acid Flesh instead, but scrambled and with no guides - hope you've got activators! Careful not to be wrong multiple times, lest you overwrite multiple mutations to the same one and need to shuffle to get them back.
Also, the CRISPR charge, being a repurposed virus, might sometimes go rogue and infect you randomly.
Congratulations. If you read everything in this guide, you should now be a full-fledged Geneticist.
DNA Infusion
Just settling with regular-old mutations not enough? Feel a need to TRANSCEND your human form? Maybe a little too into those weird Japanese cartoons? The brand new DNA infuser located genetics lets you become part BEAST, through... science! All you have to do is stick a corpse of a viable (or not) animal in and a live test subject, and the machine will destroy the corpse to replace one of the test subject's organs with a brand new mutant set. Enough mutant organs from the same type will make you a proper mutant of that type, possibly changing your species or conveying other positive or negative effects!
Mutant Type | Animals with Matching DNA | Possible Mutant Organs | Organs Required for Set Bonus | Set Bonus |
---|---|---|---|---|
Rejected | Any not listed here | Fly eyes, proboscis, fly heart, fly lungs,fly liver, fly stomach, fly appendix. | 4 | Turns you into a fully fledged flyperson, like you can become from messing up teleportation. Why the hell would you want to do this? |
Carp | Space carp | Carp lungs (Let you breathe in space but NOT on station),
Carp jaws (Stronger bites and can drop carp teeth, but can't wear anything in mask slot), Carp brain (On a timer, gives you a negative moodlet advising you to 'go exploring', IE travel to a different Z-level), Carp heart. |
4 | Allows you to move freely through space, like a carp can! |
Rat | Rodents | Rat eyes (light sensitive but have night vision),
rat stomach, rat heart, rat tongue. |
4 | Gain the ability to crawl through station ventilation, as long as your clothes don't get in the way. |
Goliath | Goliaths | Goliath eyes (night vision),
goliath lungs (lets you breathe on lavaland but NOT on station), goliath brain (no gloves but one of your arms becomes a tendril hammer), goliath heart (makes you immune to ash storms.) |
4 | Makes you immune to lava. |
Cat | Cat | Cat ears, cat tail. | N/A | You're part cat now, just like in those cartoons with those girls you like so much. |
Fox | Fox | Fox ears. | N/A | You have fox ears, just like that girl on that poster you keep on your wall. |


Cloning
Cloning was removed from the game in Jan, 2020. This is only for historical reference.
Expand for the old guide to cloning.
For a cloning process we need a dead body and cloning equipment, which can be found in your Cloning Room.
- First of all, you have to know that for all things cloning, the Chief Medical Officer has a final say. He is your boss on this side of Genetics. If he tells you to clone someone and not some other guy, you do it. The only person with higher say than him on these matters is the Captain.
- On to the specifics! How to clone: Just grab or pull a body and stuff it into the DNA Scanner and close the door. If you want to remove someone from a Scanner, click on it to open the door. Unless the Scanner is locked, the person/monkey inside is going to pop right out.
This is the cloning console menu. - When the Scanner is occupied, interact with the Cloning Console. You will see a few options. The most important one is "scan". Click it. If they can be cloned, scanning will succeed regardless of whether they're in their body or not. There are several possible errors that can happen when you try to scan. See the section about cloning errors for details.
- If scanning is successful, you will get a Successful Scan -message. That means you now have that person's cloning data saved. You can use this record to steal their genetic data at any time, but cloning is more limited - if their last death happened after they got scanned, any attempts to clone using the scanned record will fail.
This is what you see after clicking "View Records". - After you actually have DNA data from a person, click Check Records, and then click View Record of the person who you want to clone. You will see a list of their UI(Unique Identifiers) and their SEs (Structural Enzymes). These can be copied and pasted with a cloning data disk (see one of the images to the right). Click Clone. You will notice that the Cloning Pod is now fully active, with a shadow inside. That is the new body. You can now take the old corpse out of the DNA Scanner, strip it completely so the cloned person can have their stuff back, and place the old corpse inside a body bag in the morgue. You don't have to worry about the old corpse anymore.
This is what can you see after clicking a specific "View Record" under "View Records". If you have an ID with cloning access you can delete a record. Otherwise it will say "access denied" when trying to delete it. If you have inserted a "cloning data disk" you have additional options to save or load UE, UI and SE (dormant mutations) to and from that disk. - The cloning process takes about 2 or 3 minutes depending on upgrades. For whoever is getting cloned, it may feel like a very long time. While the person is getting their new body formed, take their belongings and stuff them all into a locker, so they're not scattered all over or stolen. Cloning the captain and leaving their ID or other secure items on the floor is bad.
- Aborted cloning: Use this as traitor to screw with that assistant who talked smack to you earlier. During the cloning process, it is possible to eject the incomplete clone by unlocking the Cloning Pod with your ID and ejecting the unfinished clone (needs to be >40% done) or by getting an Engineer to unlock the Genetics APC so you can shut off the power temporarily, which also causes the clone to (instantly, no matter how done) eject. This will usually clone people without limbs or vital organs, making them die quickly.
- The cloned people often have cellular damage. If so, take them to cryo to fix it.
- After the pod is empty, feel free to clone your next patient, and to let the old one out, since they most likely don't have clearance to open the door.
- If R&D has been doing their job, they might upgrade the cloner to a level where it can autoprocess. If this is the case, you only have to press the Autoprocess button on top of the window, and the cloner will scan and clone automatically. This is useful to process a large pile of bodies quickly. Scan them one at a time, and autoprocess will do the rest.
Hark! A Husk!
So you've come across a husk (a grey corpse) on your floor, which means you can't clone that poor sod without upgrades. Before you go throwing that body in the morgue, they can still be helped!
- First off, make sure it's a husk. Throw the body into a DNA Scanner, if it says Subject no longer contains the fundamental materials required to create a living clone, then you have yourself a husk (if your DNA Scanner had been updated to the max by the Scientists, you could clone the husk right now. So if you know they've been doing their R&D, ask them).
- Take the body down to Surgery.
- Pester the CMO or a Medical Doctor to extract the brain, or do it yourself.
- Put the brain in the DNA scanner like you would a body.
Optionally a husk can be unhusked with rezadone. If all goes well then your cadaver will be reborn.
Changeling Victims
If examining the husk shows "He/she is limp and unresponsive; there are no signs of life... " it means the body has a soul online. If the corpse still can't be scanned in fully upgraded cloning, it's possible it was someone who got absorbed by a changeling. There appears to be no easy way to revive absorbed victims. Not even through brain transplants.
Helping the Headless
Sometimes you'll find a corpse whose head is separated from their body. Thanks to the marvels of modern science, this is not a problem!
- If you have a head or a brain, just chuck it into the cloner as normal. This may require the DNA scanner to be upgraded though. To clone a head or brain you must throw it into the DNA Scanner by activating throw with R and then clicking it, or by walking into the DNA scanner and dropping the head/brain. Then click the cloner to close it.
- If you don't have the head, but you have the body, not all hope is lost: take a blood sample and give it to the botanist to make a replica pod, and the deceased guy will be reborn as a podperson!
- If you have neither, he's dead for good.
Cloning Plasmamen
If the patient is a plasmaman, cloning them will be complicated by the fact that the naked patient will burn in the station's atmosphere. This can be dealt with by using showers to keep the patient from catching fire, then dressing them in a plasma envirosuit.
- Put plasmaman into cloning scanner
- Scan them, start the cloning process
- Drag their dead body to cloning pod
- Undress them and leave their clothes in a pile
- Turn on shower near cloning pod
- Once they pop out of cloner, put them under shower and wait for them to dress up
If the patient is a naked or beheaded plasmaman, follow these additional steps:
- Once they pop out of cloner, put them under shower and feed them a few Salbutamol pills (if available), or if desperate, keep a syringe of Perfluorodecalin ready in case you need it. Plasmamen suffocate if they don't have plasma to breathe!
- Yell at cargo to order plasmaman supplies. In the meantime, bug Engineering/Atmos for a filled plasma tank.
Empty Cloning
Cloners have the option to "Empty Clone" a record, creating a mindless replica of a person. To complement this function, cloners can do Body-Only scans, which can only be used to create empty clones but not real clones, and bypass the sentience restrictions that ordinary scans have. These body-only entries can be deleted without requiring access.
Cloning Errors
Error message | Cause | Solution |
---|---|---|
Unable to locate valid genetic data. | Whatever you put inside the scanner doesn't have valid (humanoid) DNA. | Stop putting bees in the scanner. |
Subject's brain is not responding to scanning stimuli. | The person inside has suicided or signed an infernal contract. Cloning is impossible. | Let the Cook take care of them or put the body in the morgue. |
Subject no longer contains the fundamental materials required to create a living clone. | You're trying to scan a body that's been husked or smashed by megafauna, but your scanner doesn't have a (tri-)phasic scanning module. | Remove the brain and scan it. Yell at RnD to upgrade your scanner. |
Mental interface failure. | The corpse has no ghost associated with it. | Try again in a few seconds - ghosts get notified when someone attempts to scan their body. No success? Let the Cook handle it. |
Subject already in database. | That person has already been scanned. | Start the cloning process. Want to update the current clone scan? The CMO can delete scan files. |
Initialisation failure. | The patient is still alive. | Try again when the patient is dead. |
Unable to initiate cloning cycle. | Cloning has been disabled in the server config. | Yell at admins and hand the corpse over to the Chef. |
Corpse has no head. | Some asshole decapitated your guy - clone scanning is impossible without a brain. | Draw a blood sample and ask Botany to clone them with the Replica Pod plant. Can't draw blood either? Your patient is out of luck. |
Keep in mind that patching up a corpse with Synthflesh and then reviving it with Strange Reagent bypasses a lot of these issues.
The Gene Genie - The Traitorous Geneticist
Sorry for the bad chapter title. I wanted to use that for a very long time.
So, you learned how to do your job successfully, and how to be a credit to the station. You learned how to manipulate genes. Now you want to learn what the hell to do when the syndicate is the one writing your checks! Well, fret not! I will give you some pointers. But these are mostly tips - traitorous objectives differ wildly, and change your actions way too much for me to write a real guide on it.
Revolutionary
If you managed to kill a head of staff, copy their identity with a DNA scanner and apply it to yourself. Impersonating a head of staff during a revolution is useful since they are usually exempt from implanting.
Traitor
Depends on your objective. If it's a hard one, like stealing the AI... well, you're fucked. Keep working on those powers! As soon as you have Hulk + TK, go for it as you wish. No tips here.
If your objective is a simple one, though, like stealing the hand tele, there are more approaches to this. As the above tip, you can just break the walls with TK Hulk, but that is rather crass. There's a more roundabout, but classier way to tackle this. Take a monkey from the pen, transform it in a human. Take its UI+UEs, make an injector, stuff it in your pocket with a label like "Clean Backup - Alexa White".
Now get your own UI+UEs and name it "Clean Backup - Original" or something. Avoid using your name. Now, go hide somewhere close to the item's location, stick yourself with the monkey injector, spawn doorjack, stick ID and PDA in your backpack. For added stealth, get a different outfit. doorjack your way to the captain's room, get his hand tele, RUN RUN RUN. The AI might see you, so it would also be good if you spawned an agent card so you can't be tracked. If anyone sees you, they're not going to see your actual name, only the humanized monkey's name. Hide, stick yourself with your own stuff, change clothes, walk away smoothly.
If you have to kill someone, same stuff from rev.
Also, never forget identity theft. Since you can take someone's complete identity, including looks, you can have some fun with that.
Changeling
You can DNA sting humanized monkeys to quickly gather stored genomes. Similarly, once people start coming for mutations, you will have plenty of DNA to collect.
Returning to Monke
If you're looking for combat or stealth bonuses, you may use Monkified to get the monkeys', as well as several useful mutations (e.g., Telekinesis, Shock Touch, Chameleon, Gigantism and Dwarfism). Monkeys have the ability to steal items from people's hands, ventcrawl, and several other benefits. The transformation is unexpensive and available extremely early in the round (unlike the Xenobiologist's slime transformation).
Alternatively, there are gorillas. Since the radiation modernization changes (Oct, 2021), you have a nearly-exclusive access to gorillas. You may transform monkeys into gorillas, including yourself, other crewmembers or antagonists.
Given their status as a simplemob, gorillas are immune to wounds and most chemicals—essentially the Hulk's weaknesses. They are additionally immune to stuns and shoves (like Hulks), viruses, and mutations. Unlike Hulks, they are unable to destroy reinforced walls.
- Note that gorillas are thus also immune to the benefits of those, and to surgeries. Healing is going to be more complicated than for hulks, and someone may Lazarus their carcasses to assist against the other gorillas.
The gorilla AI is extremely hostile, keeping aggro until their target is dead, and have a tendency to delimb corpses people that are unconscious (incl. hard crit).
To transform a monkey into a gorilla, you have two options:
- Genetic bombing: once above 2500 genetic damage, monkeys have a 25% chance per second to transform.
- Mind-Magnification Helmets: when removing MM helmets, the sentient monkey has a slight chance (2.5%) to turn into an equally sentient gorilla.
Additionally, the Traitor geneticist's uplink offers Gorilla Cubes and an autoinjector turning them into a gorilla.