Guide to genetics: Difference between revisions

From /tg/station 13 Wiki
Jump to navigation Jump to search
XDTM (talk | contribs)
Separated indicators and message, added text colors, removed papyrus, joke and vineta
 
(142 intermediate revisions by 23 users not shown)
Line 1: Line 1:
{{Needs revision
{{Needs revision|reason=Several new mutations were added and most mutations were tweaked or had values rebalanced in mid-2024, largely from PR #83652. More info needed on changes}}{{Speech
|reason = Not found the mutations "Joke", "Papyrus", and "Vineta" inside the code. Check if it is a feature that is going to be implemented.}}
{{Speech
  |name=Ruth McVork
  |name=Ruth McVork
  |text=Welcome to genetics, brother! Are you feeling good? You SHOULD feel good! You are now like unto a tiny god! Are you prepared to be what you were born to be? Are you ready to save the station (or totally fuck it up)?
  |text=Welcome to [[Genetics]], brother! Are you feeling good? You SHOULD feel good! You are now like unto a tiny god! Are you prepared to be what you were born to be? Are you ready to save the station (or totally fuck it up)?
''Chin up, buddy. It's not that hard. But before you start grabbing those monkeys from the pen, you should know the basics.
''Chin up, buddy. It's not that hard. But before you start grabbing those monkeys from the pen, you should know the basics.
  |image=[[File:Geneticist.png|64px|right]]
  |image=[[File:Geneticist.png|64px|right]]
Line 11: Line 9:
== The Department ==
== The Department ==
[[File:Genetics.png|thumb|240px|right]]
[[File:Genetics.png|thumb|240px|right]]
Welcome to [[Genetics]]. Just across the morgue lies a mystical realm where some of Nanotrasen's greatest minds entertain themselves by toying the Human Genome into knots.
Welcome to [[Genetics]].


The first thing you're going to see is that our department has two rooms. The first, the one you walk into as you enter from medbay, is the Cloning room. It has only one Cloning Console, one DNA Scanner, and one Cloning Pod. More on this later.
This room has two [[Machines#DNA_Scanner|DNA Scanners]] and two DNA Scanner Access Consoles, along with some disk boxes and other supplies. The disks are extremely useful, as we will see later.


The second room is the one where you're going to spend the most of your time. This is where things get done, where people go to become hulking supermutants, where you are going to do. Your. Job. This room has two DNA Scanners and two DNA Scanner Access Consoles, along with two diskette boxes and a few lockers. The medicine locker has a syringe box and anti-toxin bottles. This is quite useful, as any tampering with genetic code gives Toxin damage. The bio-hazard locker has pretty much what you expect it to have - a bio suit and bio hood. Useful if a disease breaks out. The diskettes are also extremely useful, as we will see later.
A nearby containment room holds your test subjects. These monkeys are going to be your guinea pigs. You are going to experiment on them, and make them suffer quite a bit. It's pretty inhumane. But such is life, and after a while it will all be worth it.


The third room has your test subjects! These monkeys are going to be your guinea pigs, you are going to experiment on them, and make the suffer quite a bit. It's pretty inhumane. But such is life, and after a few seconds, it will all be worth it. They actually have it pretty easy, it's better than getting gibbed and eaten.
== [[File:scanner.gif|32px]][[File:Medcom.gif|32px]] DNA Modification ==
[[File:Unique_identifiers_tab.png|thumb|200px|right|This is the "Enzymes" tab. The "Radiation Emitter" function may randomize certain individual cosmetic features of the person inside, as well as damage their DNA. This menu can be used to transfer identities between people, but it can't be used to change a person's species. This information can also be stored on cloning data disks. Regarding the genetic research, listen to the direct orders of the [[Research Director]]]].


This is going to be your home, buddy. Get used to it. It grows on ya!
Now, let's get you acquainted with the DNA Scanner Access Console. It has a few things of note. First you need to learn some terms:


===Unique Enzymes===
* Unique Enzymes (UE) = '''Your name'''. Even if you mutate the UE it will have no effect on the name. What you can do however, is to transfer UE from one person to another, copying their name.


==[[File:scanner.gif|64px]][[File:Medcom.gif|64px]][[File:Clone.gif|64px]] Cloning ==
===Unique Identifiers===
When you first hear about "cloning", you may think that people are referring to making many clones of yourself so you can take over the station. This is not the case (although that can be done too, just not exactly that way). Cloning is a process of of reviving someone who has died. For a cloning process we need a dead body and cloning equipment, which can be found in your Cloning Room.
* Unique Identifiers (UI) = '''Your cosmetic details''' - eye color, skin color, hair style, hair color and gender. <br>


# First of all, you have to know that for all things cloning, the [[Chief Medical Officer]] has a final say. He is your boss on this side of Genetics. If he tells you to clone someone and not some other guy, you do it. The only person with higher say than him on these matters is the Captain.
In the DNA scanner access console there is a tab named "Enzymes". This tab can be used to copy UE and UI between people.
# On to the specifics! How does cloning work, you ask? Well, it's quite simple! Just '''grab or pull''' a body and stuff that puppy up '''in the [[DNA Scanner]] and close the door'''. If you want to remove someone from a Scanner, click on it to open the door. Unless the Scanner is locked, the person/monkey inside is going to pop right out.
*Click "Save" to save a person's UE + UI to the console. You can not save mutations this way (anymore).
# After the Scanner is already occupied, '''interact with the Cloning Console'''. You will see a few things. Now, the most important is the first. Click '''Scan''' to see if the person inside is actually not an empty husk! If there is no ghost inside the corpse, you will get a ''"Mental interface failure!"''-message, and you will not be able to clone that person. If that happens, try waiting a minute and try again (the ghost gets a message in their chatlog when their body is put into a Cloning Pod and it might take a few seconds to notice it). If they still do not respond, however, take the corpse to the morgue and be done with it. Corpses who seem to have suicided with ''no hope of recovery'' cannot be cloned and you should be taken straigh to the morgue.
*Click "Transfer" to copy the genes of the buffer to whoever is inside the scanner. You can choose between '''Enzymes''' (UE), '''Identity''' (UI) and '''Full Makeup''' (UE+UI).
# If there IS a [[ghost]] in that corpse, however, you will get a '''''Successful Scan'' -message'''. That means you now have that person's cloning data saved. You can use that at any time. But, after it's used, it's erased from the records. The only way you can save a person's genetic data is with a Cloning Diskette, which is found in the DNA Modification room.
*Click "Transfer (Delayed)" to copy the genes of the buffer to the next person who steps into the scanner and closes it (such as yourself). This option is only available if the scanner is empty.
# After you actually have DNA data from a person, '''click Check Records''', and then '''select the person who you want cloned'''. You will see a list of their UI+UE (Unique Identifiers + Unique Enzymes) and their SEs (Structural Enzymes), which are quite irrelevant. '''Click Clone'''. You will notice that the Cloning Pod is now fully active, with a shadow inside. That is the new body. You can now '''take the old corpse out of the DNA Scanner''', '''strip it completely''' so the cloned person can have their stuff back, and '''place the old corpse in the morgue'''. You don't have to worry about it anymore.
*Click "Print" to print a DNA injector containing the genes of the saved buffer. Injecting this into a person will transfer the UE, UI or UE+UI to that person. Unlike mutation [[#Activators_and_Mutators|injectors]] however, these DNA injectors are not permanent, and will only last for a short while after injected.
# The cloning process takes from 2 to 3 minutes. For whoever is getting cloned, it seems like a very long time. But it's not long for you. While the guy is getting his new body set up, take his '''belongings and stuff them all in the locker''' right by the cloning pod, so their stuff isn't scattered all over. Plus, cloning the captain and leaving his ID and other secure items on the floor sure is bad.
#* '''Hypercloning:''' Use this if you are in a hurry and you'll be 3x as efficient at cloning. During the cloning process, it is possible to eject the incomplete clone by unlocking the Cloning Pod with your ID and ejecting the unfinished clone (needs to be >40% done) or if by getting an Engineer to unlock the Genetics APC so you can shut off the power temporarily, which also causes the clone to (instantly, no matter how done) eject.
#::* The clone will not live long and cannot function like this, so it needs to be stuffed into a Cryogenics chamber where the Cryoxodone will repair cellular damage
#::* After the clone has been finished cryogenic treatment, give them Mannitol if some was not included in the Cryotubes chemical mixture
# After the pod is empty, feel free to '''clone your next patient''', and to let the old one out, since they most likely don't have clearance to open the door.
# If R&D has been doing their job, they might upgrade the cloner to a level where it can autoprocess. If this is the case, you only have to press the Autoprocess button on top of the window, and the cloner will scan automatically (also allowing self-scans) and clone anyone in the backup storage as soon as they die.


=== [[File:Husk.png|64px|OH GOD OH FUCK]] Hark! A Husk! ===
===Structural Enzymes===
So you've come across a [[husk]] (a gray, dead guy) on your floor, which means you can't clone that poor sod. Before you go throwing that body in the morgue, they can still be helped!
* Structural Enzymes (SE) / Genetic Sequence = '''Your mutations'''. They contain data relevant to your genetic structure. This governs your race and mutations. The term "Structural Enzymes" is no longer used by the DNA scanner access console since it was replaced with "Genetic Sequence" (which is the same thing), but the term may still show up elsewhere.


# First off, make sure it's a husk. Throw the body into a DNA Scanner, if it says ''Subject no longer contains the fundamental materials required to create a living clone'', then you have yourself a husk (if your DNA Scanner had been [[Guide_to_advanced_construction#DNA_Scanner|updated]] to the max by the Scientists, you could clone the husk right now. So if you know they've been doing their R&D, ask them).
=== Genetic Sequencer ===
# Take the body down to [[Surgery]].
[[File:Genetic_Sequencer.png|thumb|200px|right|This is what the Sequencer tab may look like with a human in the scanner.]]
# Pester the CMO or a Medical Doctor to extract the brain, or do it yourself.
In the DNA scanner access console there is a tab named "Sequencer". Here you will alter genes to find mutations. There are '''four''' types of blocks: A, T, C and G. Each pair of letters in the boxes are connected. '''A goes with T, and G goes with C.''' Order does not matter. Each pair has a correct combination of "AT, TG, CG or GC" that needs to be filled. If you see a an unmodified pair be X-T it means the right combination of that pair is A-T. When all 16 pairs have the right blocks, the mutation will activate and you will be able to store it. Monkeys can only have the ''monkified'' mutation unless [[#Humanizing_a_Monkey|humanized]]. Once you have found the name of a mutation, that mutation will be permanently identified in all DNA scanner access consoles. <br>
# Run back to Genetics and grab a humanized monkey.
# Return to Surgery and remove his brain too. Do whatever you want with that one, it isn't important.
# Now shove the husk's brain into the monkeyman's corpse and clone the monkeyman.


If all goes well then your cadaver will be reborn! Admittedly in a different body.
You might want to disable the monkey mutation by replacing one of the healthy pairs with another letter. How to do all this will be detailed in [[#Guide_to_finding_and_using_mutations|the guide below]]. <br>


=== Helping the Headless ===
====[[File:Gene_scanner.gif]] Genetic Sequence Scanner====
Sometimes you'll find corpses who are lacking a head. Since cloning requires a brain, you cannot directly clone them.
[[File:Gene_scanner_results.png|thumb|200px|right|What it looks like after clicking someone with the "Genetic Sequence Scanner" item, and then using the Genetic Sequence Scanner in hand and selecting "Mutation 39". Note that we now know that the first pair should be C-G. ]]
The more difficult mutations will have a lot of unknown (X-X) pairs. You cannot just randomly enter A-T, since it's predetermined what it's supposed to be. Knowing all this, you could whip out the genetic sequence scanner [[File:Gene_scanner.gif]] from your pocket. If you're looking for the correct pairs of mutation 39, scan people until you find a person with mutation 39. Then use the scanner in your hand for a menu to pop up. In the menu, select "mutation 39". This gives you a reading which will likely give you more information about which pairs you need to finish mutation 39.
[[File:Genetic_Sequencer_solved.png|thumb|200px|right|What it looks like after correctly filling all pairs. Mutation 39 turned out to be ''monkified''. Since solving a mutation activates it, the subject in the scanner is now a monkey.]]<br>


#If you have the head, use a surgical saw or any sharp item (such as a glass shard) to extract the brain, then put it on a monkeyman's corpse, using the same procedure as above.
You can use your Genetic Sequence Scanner [[File:Gene_scanner.gif]] on a DNA scanner access console to permanently synch the item, which makes you see the names of discovered mutations when scanning people with it.<br>
#Alternatively, get robotics to augment the body with a cybernetic head, then insert the brain in there, and put the body in the cloner.
#If you don't have the head, but have the body, not all hope is lost: take a blood sample and give it to the botanist to make a replica pod, and the deceased guy will be reborn as a podperson!


== [[File:scanner.gif|64px]][[File:Medcom.gif|64px]] DNA Modification ==
More info about some of the other tabs can be found in the [[#Guide_to_finding_and_using_mutations|guide further below]].
Your boss here is no longer the [[Chief Medical Officer]]. Do not feel forced to listen to his orders, except when it comes to cloning. Regarding the research, listen to direct orders from the [[Research Director]] as well as the [[Captain]]. For security reasons allow NO ONE ELSE in the Modification room. Simple as that.


Now, let's get you acquainted with the DNA Scanner Access Consoles next to the monkeys. It has a few things of note. First of all, you're going to notice two clickable lines:
===[[File:Hulk.png]] List of Mutations===
* ''Modify Unique Enzymes (UE) / Unique Identifiers (UI)''
{{Anchor|Mutations and Their Consequences}}
* ''Modify Structural Enzymes (SE)''
 
You might ask yourself: What does this mean?
* Unique Enzymes = just what identify who you are, your name. Even if you change them, it will have no effect. What does change stuff is you transfering them from one person to another, effectively changing their name.
* Unique Identifiers = merely your cosmetic details - eye color, skin color, hair style, hair color and gender. You don't really have to mess with any of these, and they are quite unimportant.
* '''Structural Enzymes = extremely important!''' They contain data relevant to your genetic structure. This governs your race, and messing with it carelessly might give you disabilities. For those that handle genes with care, however, great benefits are to be had.
 
[3F3] [5B1] [4A7] [391] [7FF] [102] [07E]
[7B9] [130] [230] [4E0] [552] [7A4] [715]
Structural Enzymes or SEs like this. Well, not exactly this, this is just an example. Everyone's SEs are individual. They might also just be a one long line instead of two, depends if you stretch your DNA Access Console screen window. The SEs consist of 57 characters which are divided into '''19 sub-blocks''', with 3 pieces each. Let's see what purpose these blocks and characters have.
 
 
=== Structural Enzymes - Powers, Disabilities & Species ===
There are '''19 blocks''' which control '''disabilities or powers''' and '''one block''' which controls whether the subject is a '''human or a monkey'''. The string is in '''Hexadecimal''' - which means base 16 in math terms. It means a number can range from 0 - as normally, zero - to F - equivalent of <strike>16</strike> 15. So, it can go like this, from lower to higher:
<font color=#FF000>'''0 1 2 3 4 5 6 7 8 9 A B C D E F'''</font>
 
That means that a result of '''F is higher than a result E'''. This is important, so remember this. '''"Keep this block below 8xx"''', means you have to keep the '''first sub-block in a block below 8''', and the subsequent sub-blocks don't matter. "Keep that block above DAC", means that that block must have it's first sub-block equal to or higher than D, if it is equal, the second sub-block must be equal to or higher than A... and so forth.
 
The first number in each block is the most important one. It controls whether a disability is active or inactive, whether a power has a chance to activate or not, and the race of the subject.
 
 
=== [[File:Hulk.png|64px]] Mutations and Their Consequences ===
Before we start splicing, you must know what possible monstrosities can be done to a human.
Before we start splicing, you must know what possible monstrosities can be done to a human.
Normally unobtainable mutations are highlighted in red text.


{| class="wikitable" style="width:80%" border="1" cellspacing="0" cellpadding="2"
{| class="wikitable sortable mw-collapsible" border="1" cellspacing="0" cellpadding="2"
! style='background-color:#3BB9FF; width:10%'|Mutation Name
! style='background-color:#3BB9FF;'|Mutation Name
! style='background-color:#3BB9FF;'|Description
! style='background-color:#3BB9FF;'|Description
! style='background-color:#3BB9FF; width:30%'|Indicators
! style='background-color:#3BB9FF;'|Indicators
! style='background-color:#3BB9FF; width:20%'|Message
! style='background-color:#3BB9FF;'|Message
! style='background-color:#3BB9FF;'|How/Where to Obtain
! style='background-color:#FF7F56;'|Instability
 
|-
|-
!Telekinesis
!Telekinesis
|This power allows the subject to control things with their mind, from far away! It is the most sought after power, since it allows for incredible deeds, and makes a strong robuster nearly immortal.
|''"A strange mutation that allows the holder to interact with objects through thought."''
|Appears as a blue glow around the subject's head.  
Subject can control objects with their mind, from far away! It is the most sought after power, since it allows for incredible deeds, and makes a strong robuster nearly immortal. To use it, switch to an empty hand and click on an object (note that, if they can, your character/the game will prioritize picking up an object normally over picking it up telekinetically). A circle symbol will appear underneath the object and in your hand and you can now control the object. Subject can also use any console from a distance.
|Appears as a blue glow around the subject's head.
|style='color:#0000ff'|''"You feel smarter"''
|style='color:#0000ff'|''"You feel smarter"''
|Genetics / [[Sects|Punished God sect]]
|{{Positiveinstabilitymajor}}
|-
|-
!Elastic Arms
|''"Subject's arms have become elastic, allowing them to stretch up to a meter away. However, this elasticity makes it difficult to wear gloves, handle complex tasks, or grab large objects."''
Subject can grab objects and interact (help, attack, and grab) with mobs up to two tiles away unless there is a structure, like a table, or mob in the way. They cannot pull others around while using your elastic arms. Their fingers will become chunky, so you can't use guns, batons and computers. Subject also cannot wield items with both hands.
|\
|style='color:#ff0000'|''"You feel armstrong!"''
|Genetics
|{{Positiveinstabilitymajor}}
|-{{Anchor|Hulk}}
!Hulk
!Hulk
|This is pretty obvious. Subject becomes extremely strong, enough to punch through reinforced walls, and is unable to speak without yelling. The subject is also immune to stuns and cannot be pushed past.
|''"A poorly understood genome that causes the holder's muscles to expand, inhibit speech and gives the person a bad skin condition."''
Only works on human subjects. Subject becomes extremely strong, enough to punch through reinforced walls, and is unable to speak without yelling. Subject is also immune to stuns and slowdowns from stamina and normal damage, and cannot be pushed past. Breaking walls and machinery deals heavy brute damage to your arm. This mutation is lost when the subject falls to critical health.
* Can swing people by their tails. To do this, get your tailed victim in at least a neck grab (lvl 3 grab), enable throw mode, then click in the direction you want to throw.
* Makes you extra vulnerable to cold and take brute damage from it.
* Prevent you from using guns, batons and computers, and wielding items with both hands.
 
'''This mutation is mutually exclusive with Ork.'''
|Subject turns green and has red eyes.
|Subject turns green and has red eyes.
|style='color:#0000ff'|''"Your muscles hurt."''
|style='color:#0000ff'|''"Your muscles hurt."''
|Radioactive + Strength
|{{Positiveinstabilitymajor}}
|-
!Ork
|''"A mutation caused by a mixup of hulk genes which severely impacts speech centers in owners' brains."''
Works the same as [[Guide_to_genetics#Hulk|Hulk]] but you may verbalize some words in Ork Language.
'''This mutation is mutually exclusive with Hulk.'''
|Subject turns brown and has red eyes.
|style='color:#0000ff'|''"You feel significantly dumber!"''
|Hulk + Clumsy
|{{Positiveinstabilitymajor}}
|-
!Cold Adaptation
|''"A strange mutation that renders the host immune to damage from low temperature environments. It also prevents the host from slipping on ice."''
'''This mutation is mutually exclusive with Heat, Thermal, and Pressure Adaptation.'''
|Subject has a pulsating blue "aura".
|style='color:#0000ff'|''"Your body feels refreshingly cold."''
|Genetics
|{{Positiveinstabilitymoderate}}
|-
!Heat Adaptation
|''"A strange mutation that renders the host immune to damage from high temperature, including being set alight, though the flame itself still burns clothing. It also seems to make the host resist ash storms."''
'''This mutation is mutually exclusive with Cold, Thermal, and Pressure Adaptation.'''
|Subject has a pulsating orange "aura".
|style='color:#0000ff'|''"Your body feels invigoratingly warm."''
|Genetics
|{{Positiveinstabilitymoderate}}
|-
|-
!Cold Resistance
!Thermal Adaptation
|This makes the subject resistant to cold and lack of pressure, effectively allowing it to survive in space (they still have to wear internals, however). This will not make them immune to fire.
|''"A strange mutation that renders the host immune to damage from both low and high temperature environments. Does not protect from high or low pressure environments."''
|Subject has a pulsating orange-blueish "aura".
 
|style='color:#0000ff'|''"Your body feels warm."''
'''This mutation is mutually exclusive with Cold, Heat, and Pressure Adaptation.'''
|Subject has a pulsating green "aura".
|style='color:#0000ff'|''"Your body feels pleasantly room temperature."''
|Genetics
|{{Positiveinstabilitymajor}}
|-
|-
!X-Ray Vision
!Pressure Adaptation
|Also a very good power. Basically, it gives the subject the ability to see everything that is beyond their normal vision: walls, furniture, even other people! This, combined with Telekinesis, is a deadly combination.
|''"A strange mutation that renders the host immune to damage from both low and high pressure environments. Does not protect from temperature, including the cold of space."''
|Subject's eyes ''"glow eerily"'' if looked at with a penlight.
 
|style='color:#0000ff'|''"The walls suddenly disappear."''
'''This mutation is mutually exclusive with Cold, Heat, and Thermal Adaptation.'''
|Subject has a pulsating pink "aura".
|style='color:#0000ff'|''"Your body feels numb."''
|Genetics
|{{Positiveinstabilitymoderate}}
|-
!Thermal Vision
|''"The user of this genome can visually perceive the unique human thermal signature."''
Subject can see people even through walls and in darkness for 10 seconds, for the cost of 10 eye damage.
|\
|style='color:#0000ff'|''"You can see the heat rising off of your skin..."''
|Genetics
|{{Positiveinstabilitymajor}}
|-
|-
!Chameleon
!Chameleon
|The subject becomes able to subtly alter light patterns to become invisible, as long as they remain still.
|''"A genome that causes the holder's skin to become transparent over time."''
Subject subtly alters light patterns to become invisible, as long as they remain still.
|Subject starts fading into the background.
|Subject starts fading into the background.
|style='color:#0000ff'|"''You feel one with your surroundings.''"
|style='color:#0000ff'|"''You feel one with your surroundings.''"
|Genetic
|{{Positiveinstabilitymajor}}
|-
|-
!Dwarfism
!Dwarfism
|Turns the subject into a manlet, making them unusually shorter than the rest of the crew. Dwarfs can pass over tables without stopping.
|''"A mutation believed to be the cause of dwarfism."''
Subject turns into a manlet, making them unusually shorter than the rest of the crew. Dwarfs can pass over tables without stopping and are known to have less tolerance to mutations.
 
'''This mutation is mutually exclusive with Acromegaly and Gigantism.'''
|Subject looks smaller.
|Subject looks smaller.
|style='color:#0000ff'|''"Everything around you seems to grow.."''
|style='color:#0000ff'|''"Everything around you seems to grow.."''
|Human Species
|{{Positiveinstabilityminor}}
|-
|-
!Nearsightedness
!Acromegaly
|Makes the subject's screen go hazy at about halfway from the edge of your whole vision. It's not THAT bad, and can be temporarily fixed by using prescription glasses.
|''"A mutation believed to be the cause of acromegaly, or 'being unusually tall'."''
Subject's legs and torso become more extensive. Not the same as Gigantism.
 
'''This mutation is mutually exclusive with Dwarfism.'''
|Subject looks taller.
|style='color:#0000ff'|''"You feel a small strange urge to fight small men with slingshots. Or maybe play some basketball."''
|[[Quirks#Spacer|Spacer Quirk]]
|{{Negativestabilitymoderate}}
|-
!Gigantism
|''"The cells within the subject spread out to cover more area, making them appear larger."''
Subject shows increased tackling abilities, both offensive and defensive. Not the same as Acromegaly.
 
'''This mutation is mutually exclusive with Dwarfism.'''
|Subject is slightly larger than normal.
|style='color:#0000ff'|''"Everything around you seems to shrink.."''
|Genetics
|0
|-
!Near Sightness
|''"The holder of this mutation has poor eyesight."''
Subject displays difficulty to see objects far away. Perscription glasses are recommended.
|\
|\
|style='color:#ff0000'|''"Your eyes feel strange."''
|style='color:#ff0000'|''"You can't see very well."''
|Genetics
|{{Negativestabilitymoderate}}
|-
|-
!Epilepsy
!Epilepsy
|Subject starts to fall down and keeps shaking all the time. They're horrible, and there's no easy cure short of fixing the block.
|''"A genetic defect that sporadically causes seizures."''
|Subject falls down.
Subject periodically falls down and starts shaking.
|Subject suffers from seizures.
|style='color:#ff0000'|''"You get a headache."''
|style='color:#ff0000'|''"You get a headache."''
|Genetics
|{{Negativestabilitymoderate}}
|-
|-
 
!Cough
!Coughing
|''"A chronic cough."''
|Makes the subject drop small items you're holding, like syringes. Pretty harmless, but has potential to be extremely annyoing.
Subject periodically coughs, drop any items they're holding. Substantially harmless, but tends to get on the nerves of the subject.
|Subject coughs.
|Subject coughs.
|style='color:#ff0000'|''"You start coughing."''
|style='color:#ff0000'|''"You start coughing."''
|Genetics
|{{Negativestabilitymoderate}}
|-
|-
!Tourette's Syndrome
!Tourette's Syndrome
|The subject swears all the time. They may also experience paralysis that takes even longer than the seizures. Avoid.
|''"A chronic twitch that forces the user to scream bad words."''
Subject swears all the time and may also periodically experience paralysis.
|Subject curses out loudly and twitches.
|Subject curses out loudly and twitches.
|style='color:#ff0000'|''"You twitch."''
|style='color:#ff0000'|''"You twitch."''
|Genetics
|0
|-
|-
!Nervousness
!Nervousness
Line 147: Line 221:
|Subject stammers when they speak.
|Subject stammers when they speak.
|style='color:#ff0000'|''"You feel nervous."''
|style='color:#ff0000'|''"You feel nervous."''
|Genetic
|-
|-
!Blindness
!Blindness
|Subject goes completely blind and are now a part of a usually forgotten minority, so sad.
|''"Renders the subject completely blind."''
|Subject's eyes don't react to penlight.
|Subject's eyes don't react to penlight.
|style='color:#ff0000'|''"You can't seem to see anything."''
|style='color:#ff0000'|''"You can't seem to see anything."''
|Genetics
|{{Negativestabilitymajor}}
|-
|-
!Deafness
!Deafness
|Makes the subject deaf. Harmless at best, annoying at worst. You just don't hear anything, not even yourself.
|''"The holder of this genome is completely deaf."''
|\
|\
|style='color:#ff0000'|''"You can't seem to hear anything..."''
|style='color:#ff0000'|''"You can't seem to hear anything..."''
|Genetics
|{{Negativestabilitymajor}}
|-
!Illiterate
|''"Causes a severe case of Aphasia that prevents reading or writing."''
Subject suffers from illiteracy, becoming unable to use paper, pens, computers, and electronics that require reading.
|\
|style='color:#ff0000'|''"You feel unable to read or write."''
|Genetics
|{{Negativestabilitymajor}}
|-
|-
!Clumsiness
!Clumsiness
|Subject has a clown-like clumsiness. For those that have always wanted to be clowns. It makes the subject accidentally drop things they hold, unable to use tasers, handcuffs, guns exploding in their face etc.
|''"A genome that inhibits certain brain functions, causing the holder to appear clumsy. Honk!"''
Subject displays inhibition in certain brain functions, inducing clown-like clumsiness. For those that have always wanted to be clowns. It makes the subject accidentally drop things they hold, and unable to use tasers, handcuffs, guns without it exploding in their face.
|\
|\
|style='color:#ff0000'|''"You feel lightheaded."''
|style='color:#ff0000'|''"You feel lightheaded."''
|-
|Genetics / [[Clown|Clowns]]
!Strangeness
|{{Negativestabilitymajor}}
|Makes the subject randomly mutate. Very dangerous. Definitely be careful with this one.
|Subject mutates on their own.
|style='color:#ff0000'|''"You feel strange."''
|-
|-
!Unintelligible
!Unintelligible
|Heavily corrupts the part of the brain responsible for forming spoken sentences.
|Heavily corrupts the part of the brain responsible for forming spoken sentences, causing the subject to only be able to speak short sentences.
|\
|\
|style='color:#ff0000'|''"You can't seem to form any coherent thoughts!"''
|style='color:#ff0000'|''"You can't seem to form any coherent thoughts!"''
|Genetic
|-
|-
!Mute
!Mute
Line 177: Line 263:
|\
|\
|style='color:#ff0000'|''"You feel unable to express yourself at all."''
|style='color:#ff0000'|''"You feel unable to express yourself at all."''
|Genetic / [[Sects|Punished God sect]]
|-
|-
!Wacky
!Wacky
|Forces the subject to talk in an odd manner.
|Forces the subject to talk in an odd manner. Makes your speech in chat use the Comic Sans font normally only seen with the clown's megaphone.
|\
|\
|''"You feel an off sensation in your voicebox."''
|''"You feel an off sensation in your voicebox."''
|Genetic
|-
!Glowy
|''"You permanently emit a light with a random color and intensity."''
'''This mutation is mutually exclusive with Anti-Glow.'''
|Subject glows.
|style='color:#0000ff'|''"Your skin begins to glow softly."''
|Genetics
|{{Positiveinstabilitymini}}
|-
|-
!Cloak of Darkness
!Anti-Glow
|Enables the subject to bend low levels of light around themselves, creating a cloaking effect. '''No Longer in Genetics, but can be acquired via admin spawned injector'''
|''"Your skin seems to attract and absorb nearby light creating 'darkness' around you."''
|Subject is able to become invisible in low light situations.
Subject absorbs light in a radius around it. Works on Ethereals and Luminescents.
|"''You begin to fade into the shadows.''"
 
'''This mutation is mutually exclusive with Glow.'''
|Subject has an aura of darkness.
|style='color:#0000ff'|''"The light around you seems to disappear."''
|Glowy + Void Magnet
|{{Positiveinstabilityminor}}
|-
|-
!Smile
!Strength
|Causes the speech center of the subject's brain to produce large amounts of seratonin and a chemical resembling ecstacy when engaged. '''No Longer in Genetics, but can be acquired via admin spawned injector'''
|''"The user's muscles slightly expand. Commonly seen in top-ranking boxers."''
Subject displays better fitness and fishing skills, requiring less rest time.
|\
|\
|''"You feel so happy. Nothing can be wrong with anything. :)"''
|style='color:#0000ff'|''"You feel stronger"''
|Genetics
|{{Positiveinstabilitymini}}
|-
!Fiery Sweat
|''"The user's skin will randomly combust, but is generally a lot more resilient to burning."''
Subject periodically combusts, but grows twice as resistant to fire. [[#Genetic_Instability|Stability]] decreases the chances of combusting.
 
'''This mutation is mutually exclusive with Heat Adaptation.'''
|Subject spontaneously combusts.
|style='color:#ff0000'|''"You feel hot."''
|Genetics
|-
!Void Magnet
|"''A rare genome that attracts odd forces not usually observed.''"
You have the power to make yourself mostly invincible for a brief period at the cost of being unable to move. You will also enter this state randomly and against your will, genetic [[#Genetic_Instability|stability]] reduces how often it happens.
|Subject is periodically replaced with a hole in reality shaped like the subject.
|style='color:#0000ff'|''"You feel a heavy, dull force just beyond the walls watching you."''
|Genetic
|30
|-
!Radioactive
|''"A volatile mutation that causes the host to sent out deadly beta radiation. This affects both the hosts and their surroundings."''
One of the few radiation sources after the ''Radiation Modernization'' changes.
|Subject glows with a green aura
|style='color:#ff0000'|''"You feel it in your bones"''
|Genetic
|5
|-
!Telepathy
|A mutation that allows the user to telepathically communicate to others.
|Subject is able to broadcast its thought directly to others.
|style='color:#0000ff'|''"You hear your thoughts echo in your mind"''
|Genetic / [[Sects|Punished God sect]]
|10
|-
!Fire Breath
|An ancient mutation that gives lizards breath of fire.
Enables the user to fire explosive fireballs, hotter the less it travels.
|Subject becomes able to breathe concentrated balls of fire.
|style='color:#0000ff'|''"You feel a heat built up in your throat"''
|Lizard Species
|30
|-
|-
!Chav
!Chav
|Forces the language center of the subject's brain to construct sentences in a more rudimentary manner. '''No Longer in Genetics, but can be acquired via admin spawned injector'''
|Forces the language center of the subject's brain to construct sentences in a more rudimentary manner.
|\
|\
|''"Ye feel like a reet prat like, innit?"''
|style='color:#0000ff'|''"Ye feel like a reet prat like, innit?"''
|Genetic
|-
|-
!Swedish
!Swedish
|Forces the language center of the subject's brain to construct sentences in a vaguely norse manner. '''No Longer in Genetics, but can be acquired via admin spawned injector'''
|''"A horrible mutation originating from the distant past. Thought to be eradicated after the incident in 2037."''
Forces the language center of the subject's brain to construct sentences in a vaguely norse manner.
|\
|style='color:#0000ff'|''"You feel Swedish, however that works."''
|Genetic
|-
!Medieval
|''"A horrible mutation originating from the distant past, thought to have once been a common gene in all of old world Europe."''
Forces the language center and primary motor cortex of the subject's brain to talk and act like a knight on a quest for the Holy Grail.
|\
|style='color:#0000FF'|''"You feel like seeking the holy grail!."''
|Genetic
|-
!Pig Latin
|''"Historians say back in the 2020's humanity spoke entirely in this mystical language."''
Increase the level of skillchip' complexity the subject can handle.
|\
|style='color:#0000FF'|''"Omethingsay eelsfay offyay."''
|Genetic
|5
|-
!Insulated
|''"The affected person does not conduct electricity."''
|Subject does not conduct electricity.
|style='color:#0000ff'|''"Your fingertips go numb."''
|Genetics
|{{Positiveinstabilitymoderate}}
|-
!Shock Touch
|''"The affected can channel excess electricity through their hands without shocking themselves, allowing them to shock others."''
This gives you a non-antag ''Mansus Grasp'' that shocks people, which will do burn damage and large amounts of jittering and confusion.
Does not protect the subject against shocks.
|Subject can electrocute other people with their bare hands.
|style='color:#0000ff'|''"You feel power flow through your hands."''
|Insulated + Radioactive
|30
|-
!Transcendent Olfaction
|''"Your sense of smell is comparable to that of a canine."''
This power lets you track people by scent. Hold something in your hand and use the power to look for a scent on it. Use the power without holding anything and you'll track the scent you previously found.
|\
|style='color:#0000ff'|''"Smells begin to make more sense..."''
|Genetic
|30
|-
!Geladikinesis
|Allows the user to concentrate moisture and sub-zero forces into snow
|This mutation lets you create snow, used to build snowtiles, walls, balls and snowmen
|style='color:#0000ff'|''"Your hand feels cold"''
|Genetic
|10
|-
!Cryokinesis
|Draws negative energy from the sub-zero void to shoot freezing beams
|Lets the user shoot a bolt of cryokinesis to freeze people, objects and tiles
|style='color:#0000ff'|''"Your hand feels cold"''
|Genetic
|20
|-
!Antenna
|The affected person sprouts an antenna. This is known to allow them to access common radio channels passively.
|An antenna is visible on the user's head, and they basically have a built in station-bounced radio.
|style='color:#0000FF'|''"You feel an antenna sprout from your forehead."''
|Genetic
|5
|-
!Mind Reader
|The affected person can look into the recent memories of others.
They can read the minds of others. This will reveal the name of the target and some snippets of what the target has said in the past. Tin foil is known to block this power.
|An antenna is visible on the user's head, and the read-ee may feel something strange enter their mind.
|style='color:#0000FF'|''"You hear distant voices at the corners of your mind."''
|Antenna + Paranoia / [[Sects|Punished God sect]]
|40
|-
!Spatial Instability
|''"The victim of the mutation has a very weak link to spatial reality, and may be displaced. Often causes extreme nausea."''
|Subject randomly teleports a short distance away.
|style='color:#FF0000'|''"The space around you twists sickeningly."''
|Genetics
|{{Negativestabilitymoderate}}
|-
!Paranoia
|''"Subject is easily terrified, and may suffer from hallucinations."''
|Subject screams frequently.
|style='color:#FF0000'|''"You feel screams echo through your mind..."''
|Genetics
|{{Negativestabilitymoderate}}
|-
!Two Left Feet
|''"A mutation that replaces the right foot with another left foot. Symptoms include kissing the floor when taking a step."''
|Subject is randomly [[Status_Effects#Knockdown|knocked down]].
|style='color:#FF0000'|''"Your right foot feels... left."''
|Genetics
|{{Negativestabilitymoderate}}
|-
!Tongue Spike
|Allows a creature to voluntary shoot their tongue out as a deadly weapon.
The tongue does not grow back, and remains embedded in the target until removed.
|Subject can shoot his tongue.
|style='color:#0000FF'|''"Your feel like you can throw your voice."''
|Genetic
|15
|-
!Stimmed
|''"The user's chemical balance is more robust. This mutation is known to slightly improve workout efficiency."''
|\
|\
|''"You feel Swedish, however that works."''
|style='color:#0000FF'|''"You feel stimmed."''
|Genetic
|-
|-
!Elvis
!Chem Spike
|Forces the language center and primary motor cortex of the subject's brain to talk and act like the King of Rock and Roll. '''No Longer in Genetics, but can be acquired via admin spawned injector'''
|Allows a creature to voluntary shoot their tongue out as biomass, allowing a long range transfer of chemicals.
The tongue does not grow back, and remains embedded in the target until removed. As long as it is embedded, it allows you to transfer the chemical in your body into the target's, one single time. Much less harmful than ''Tongue Spike'' on its own.
|Subject can shoot his tongue, and inject you with chemicals.
|style='color:#0000FF'|''"Your feel like you can really connect with people by throwing your voice."''
|Tongue Spike + Stimmed
|15
|-
!Webbing Production
|Allows the user to lay webbing, and travel through it.
Subject may grow psychologically attached to laying webs if used enough.
|Subject lays webbing, or can move through some without being slowed down.
|style='color:#0000FF'|''"Your skin feels webby."''
|Genetic
|15
|-
!Internal Martyrdom
|''"A mutation that makes the body destruct when near death. Not damaging, but very, VERY disorienting."''
Subject melts into gibs upon death. Harmful to witnesses' eyes and paralyzes Silicons.
|Subject explodes in a bloody shower when in deep crit.
|style='color:#0000FF'|''"You get an intense feeling of heartburn."''
|Strong + Stimmed
|-
!H.A.R.S.
|''"A mutation that makes the body reject the head, the brain receding into the chest. Stands for Head Allergic Rejection Syndrome. Warning: Removing this mutation is very dangerous, though it will regenerate non-vital head organs."''
|Subject loses their head.
|style='color:#FF0000'|''"Something feels off."''
|Genetics
|-
!Acidic Flesh
|''"Subject has acidic chemicals building up underneath the skin. This is often lethal."''
Those buildups end up as acidic cutaneous eruptions, burning the subject. Acid-resistant clothes have been shown to protect the subject from these.
|Subject's skin frequently bubbles and pops, burning them.
|style='color:#FF0000'|''"A horrible burning sensation envelops you as your flesh turns to acid!"''
|Genetics
|{{Negativestabilitymajor}}
|-
!Spastic
|''"Subject suffers from muscle spasms."''
Subject may unintentionnally hit nearby people and machinery, and harm themselves.
|Subject frequently spasms.
|style='color:#FF0000'|''"You flinch."''
|Genetics
|{{Negativestabilitymoderate}}
|-
!Monkified
|''"A strange genome, believing to be what differentiates monkeys from humans."''
Subject transforms into a monkey. Innate mutation in humans and monkeys.
|Subject frequently spasms.
|''"You feel unusually monkey-like."''
|Genetics
|{{Negativestabilitymajor}}
|-
!Autotomy
|''"Allows a creature to voluntary discard a random appendage."''
|Subject is able to discard its limbs without surgery.
|style='color:#0000FF'|''"Your joints feel loose."''
|Genetic
|30
|-
!Biotech Compatibility
|''"Subject is more compatibile with biotechnology such as skillchips."''
Increase the level of skillchip' complexity the subject can handle.
|\
|No message
|Genetic
|5
|-
!Clever
|''"Causes the subject to feel just a little bit smarter. Most effective in specimens with low levels of intelligence."''
Allows some mobs, such as monkeys, to perform advanced actions like surgery, use computers and PDAs, and more.
|\
|\
|''"You feel pretty good, honeydoll."''
|style='color:#FF0000'|''"You feel a little bit smarter."''
|Genetic
|20
|-
|-
!style='color:#ff0000'|Stoner
|''"A common mutation that severely decreases intelligence."''
Grants the Beach Bum language, revokes all the others.
|\
|style='color:#0000FF'|''"You feel...totally chill, man!"''
|Beach Bum respawn
|}


==== [[Sects|Chaplain Religion]] exclusives ====
Mutations granted by some of the [[Chaplain]]'s [[Sects|religions]]. Their instability is set at 0.
''"Less of a genome and more of a forceful rewrite of genes. Nothing Nanotrasen supplies allows for a genetic restructure like this..."''
{| class="wikitable sortable mw-collapsible mw-collapsed" border="1" cellspacing="0" cellpadding="2"
! style='background-color:#3BB9FF;'|Name
! style='background-color:#3BB9FF;'|Description
! style='background-color:#3BB9FF;'|Message
|-
!Honorbound
|''"The user feels compelled to follow supposed "rules of combat" but in reality they physically are unable to. Their brain is rewired to excuse any curious inabilities that arise from this odd effect."''
Disallows the subject to attack people unless they are attacked first.
|style='color:#0000FF'|''"You feel honorbound!"''
|-
!Burdened
|''"The user feels compelled to injure themselves in various incapacitating and horrific ways. Oddly enough, this gene seems to be connected to several other ones, possibly ready to trigger more genetic changes in the future."''
Grants ''Telepathy'' and ''Mute'', then ''Telekinesis'' and ''Mind Reader'' as the subject becomes increasingly burdened through disabilities and debuffs (traumas, missing limbs and organs, addictions, mutations, ...).
|style='color:#0000FF'|''"You feel burdened!"''
|}
|}


'''IMPORTANT: There's also ''1 special block'' which contains the info whether the subject is a ''human or a monkey''!'''
==== Admin-spawn only mutations ====
 
{| class="wikitable sortable mw-collapsible mw-collapsed" border="1" cellspacing="0" cellpadding="2"
! style='background-color:#3BB9FF;'|Name
! style='background-color:#3BB9FF;'|Description
! style='background-color:#3BB9FF;'|Indicators
! style='background-color:#3BB9FF;'|Message
! style='background-color:#FF7F56;'|Instability
|-
!X-Ray Vision
|''"A strange genome that allows the user to see between the spaces of walls."''
Subject gains the ability to see behind walls. Replaced by the [[Research_items#X-Ray_Implant|X-Ray implant]].
|Subject's eyes ''glow eerily'' if looked at with a penlight.
|style='color:#0000ff'|''"The walls suddenly disappear."''
|{{Positiveinstabilitymajor}}
|-
!Laser Eyes
|"Reflects concentrated light back from the eyes."
Subjects gains the ability to shoot laser beams from their eyes, dealing 25 burn damage.
|Subject's eyes glow in red.
|style='color:#0000ff'|''"You feel pressure building up behind your eyes."''
|-
!Elvis
|Forces the language center and primary motor cortex of the subject's brain to talk and act like the King of Rock and Roll.
|A terrifying mutation named after its 'patient-zero'.
|style='color:#0000FF'|''"You feel pretty good, honeydoll."''
|-
!Unstable DNA
|''"Strange mutation that causes the holder to randomly mutate."''
Makes the subject randomly mutate. Very dangerous. Definitely be careful with this one.
|Subject periodically mutates.
|style='color:#ff0000'|''"You feel strange."''
|{{Negativestabilitymajor}}
|}
 
=== Guide to finding and using mutations ===
This guide here shows you step by step how to find the powers from the mysterious blocks!
 
==== First Steps ====
This guide will start with using a monkey, because they're in the pen for a reason.
 
* Start by taking a '''monkey''' from the pen.
 
* Shove it into a '''DNA Scanner''' next to the pen, by click dragging.
 
* Check the '''console''' next to it, you'll see a bunch of options. Find ''Genetic Sequencer''.
 
All mutations are randomized every round.
 
==== Humanizing a Monkey ====
Always humanize your monkey first, or their powers wont work or be savable.'''
# You and your geneticist buddy automatically share the mutations you've discovered, so work together to discover them all. Saved mutations have to be manually shared between computers using DNA Data Disks.
# Click through the mutations and find ''Monkified''. Then break a random pair by changing a letter to X with CTRL+Left Click.
# When you've done it, you'll see the name on the top has changed from "monkey" to a randomly generated name. Congratulations, you've got your very own monkey-person!
# If for any reason you got yourself some bad mutations and have no one to remove them, grab the [[Guide_to_chemistry#Mutadone|mutadone]] pill bottle in your lab. You usually have several 50u pills available, which is overkill. Dissolve a pill by pouring a tiny amount of water into a beaker (by using the beaker on a sink once), then drop a pill of [[Guide_to_chemistry#Mutadone|mutadone]] into it and take a sip. It should instantly clear all your mutations.
# [[Guide_to_chemistry#Mutadone|Mutadone]] will also clear the ''monkified'' mutation from monkeys, instantly turning them human. Use a dropper set to 1u to squirt the dissolved [[Guide_to_chemistry#Mutadone|mutadone]] into the eyes of monkeys to mass humanize them without needing any machinery. This will not make you "discover" the monkified mutation however.
 
==== Manifesting Mutations ====
Back to business! Now we'll try to make a mutation show itself to us:
 
# Find a mutation that has broken pairs.
# Start filling in the X's. This is fairly easy since most of them are connected to an A, T, C or G. So X-T would be A-T.
#* The left click increments from A to G (A>T>C>G>A) — the right click, the other way around.
# You will often find X-X pairs. Make sure the rest is fixed first and then guess it. There's 4 possibilities. AT, TA, GC and CG.
# If there's more than 2 double X-pairs, consider using the Genetic Scanner (as described [[#Genetic_Sequence_Scanner|above]]) by scanning the other monkeys, yourself, or random crew members, or the JOKER option when editing a letter, which finds the correct letter for you (on a very long cooldown—''20 minutes'' on unupgraded scanners).
# If completing all pairs didn't work, you may have messed up somewhere. Double check. Also make sure they're not still a monkey. If all else fails, move on to another mutation or [[#Scramble DNA|scramble]] their DNA.


=== [[File:DNA Injector.png|64px]] Buffers and Injectors - Saving Your Work and Handing Out Godhood ===
==== Scramble DNA ====
* This is how you '''save your work'''. A very good Geneticist once said: Save early, save often. His words are true. You have to save your every step in order to acquire a perfect serum. That means you have to be patient enough to bending the block to your will, dedicated enough to remove every disability, and responsable enough to save everything to make sure nothing goes wrong.
Clicking the Scramble DNA button will blast the subject's DNA with damaging genetic pulses, and randomize which discoverable mutations it has. This also inflicts a large amount of genetic damage at once.


* In the main DNA Scanner Access Console screen, click '''''Buffer Menu'''''. This is your buffer screen. You will notice there are THREE buffers there. More than enough. Each buffer can save either an UI, or an UI+UE, or, more importantly, an SE. Generally speaking, you will only ever bother with the SE part.
{{Anchor|Activators_and_Injectors}} <!-- Former name -->
** To '''save your work into a buffer''', once your pod is occupied, simply click '''''Save to Buffer'''''. This will save the subjects Unique Enzymes, Unique Identifiers, and Structural Enzymes. You can make individual injectors of each of these, but not one with all. What you saved is now backed up by the console, and, if not overwritten, is now safe. Good stuff. You can relabel the buffer to make sure of what it is. For instance, calling your original test subject's SE something like "Clean Backup - Stevenson, F.", or calling an SE that has Hulk isolated something like "Hulk". Simple, but very helpful to not get lost.
==== [[File:DNA Injector.png|64px]] Activators and Mutators ====
** You can '''transfer a buffer's content into the pod's occupant''', making it easier to transfer research data between subjects. Just stick a test subject in there, click ''Buffers'', as usual, then click ''Occupant'', right after ''Transfer To:''.
After manifesting a mutation in the [[#Genetic_Sequencer|Genetic Sequencer]] tab, hit ''store'' to save it to the "Storage - Mutations" tab. You can print activators and mutators from both the Sequencer and the Storage - Mutations tab.
** By using the '''Occupant - Delayed''' button, the scanner will apply the buffer's content onto the next person who enters the scanner. This is mainly useful for self-experimenting, but be sure of having a clean backup when doing so.
** '''Make use of all three buffers.''' Assuming you have a human with clean SEs inside your pod, you can save his SE in the first buffer, and name it "Clean Backup". The last two buffers can be used to find powers. Say, once you find your first power, you save it to the second buffer. Once you get your second power working with the first, save it to the third buffer. Once you get the third power working with the others, overwrite the second buffer, since it is now irrelevant. Same thing with fourth power.
** '''Diskettes''' can use them to backup your work as well! With one in your hand, click the DNA Scanner Access Console. Now enter the Buffer screen. Click ''Save To'' in there to save the data to the diskette. If the diskette is not write-protected, the data is going in there! From the main screen, you can eject the disk from the console. You can also load data from a diskette much the same way. Except you click in ''Load From'' in the buffer screen, instead of ''Save To''.


* That covers buffers. But '''"what are [[File:DNA Injector.png]] DNA Injectors?"''' you may ask yourself. Well, injectors are tiny one-shot needles, that contain buffer data, whatever it may be. That means you can now turn that sweet, sweet Hulk buffer into a small, awesome, orange/red injector! Good stuff. To turn a buffer into an injector, simply click ''Injector'' in the options below the buffer in question, after "Transfer To:". A small needle will spawn on top of the DNA Scanner Access Console. You can now stick his baby in anyone who stands around for enough time. It's important to note that unlike using the scanner, injectors have a 100% chance to actuvate power blocks, but have a limited duration; this is true of both SE and UI/UE injectors.
*'''Activators:''' An activator will permanently activate specific mutation in a person who already has mutation dormant as shown with a [[#Genetic_Sequence_Scanner|Genetic Sequence Scanner]] [[File:Gene_scanner.gif]]. For example, since all humans have the ''monkified'' mutation dormant in them, a ''monkified'' activator will always work on humans. Using an activator will not increase [[#Genetic_Instability|genetic instability]]. Used activators can be recycled into the DNA scanner access console to produce [[#Chromosome_21|chromosomes]].
** The DNA Scanner Access Console '''takes time to make another injector'''. Something like 90 seconds or close to it.
*'''Mutators:''' A mutator will manifest a mutation in a person, regardless of if that person has that mutation dormant or not. This will inflict the mutation's [[#Genetic_Instability|instability]] (causes several bad effects if it reaches 100%). The mutation and its instability may then be removed by taking [[Guide_to_chemistry#Mutadone|Mutadone]].
** Because of injectors, Geneticists are usually '''asked to give people superpowers'''. This is best judged by the Research Director, who is in charge of the research. If you want to be like Marvel and give everyone superpowers, be ready for Security Officers knocking on your door because nothing gets the station down like a herd of assistants with Hulk. So be ready to say "no" a lot. Usually the Geneticists are allowed to have powers, but note that if you run around the station while being a hulk, you're probably going to get a lot of attention from the security and be the prime suspect if (when) anything happens. Don't go on a killing/destroying rampage if you're a hulk, it is a bannable offense. <br>''Note: Admins have confirmed that if people inject themselves with a needle they found lying around that says "Godhood" on it without even asking what is in it, you will NOT get punished by turning them into monkeys. Wink wink. Just make sure to answer truthfully if asked, and not to inject it yourself. If people are stupid enough to inject themselves with unknown content, let them.''
<br>
The DNA Scanner Access Console takes time to recharge after producing an activator or mutators. Activators have a much shorter cooldown.


=== Manhandling Genes! ===
==== [[File:DNA Injector.png|64px]] Advanced Injectors ====
This guide here shows you step by step how to find the powers from the mysterious blocks!
[[File:Time-Green_advanced_injectors_first_screenshot.png|thumb|200px|right|This is the "Adv. Injectors" tab. ]]
After discovering one or more mutations, you have the option to create advanced injectors. Advanced injectors will let you save multiple mutations in a single injector. The amount of mutations in a single "save" is limited to 50 [[#Genetic_Instability|instability]] or 10 mutations. Unlike activators or ordinary mutators, these can be named anything you want. To create an advanced injector, do the following:
#Go to either the "Storage - Adv. Injectors" tab. Click "Create new injector" and choose a name to crate a new slot for mutations to be stored in.
#Go to the [[#Genetic_Sequencer|Sequencer]] tab or the "Storage - Mutations" tab and click on a stored or discovered and active mutation.
#Click "Add to advanced injector". Select the name of the slot you made in step 1. Repeat with any other mutations you wish to save to the same advanced injector.
#Go back to the "Adv. Injectors". Click ''Print''. You will print an injector with named "Advanced (name) injector".
 
==== Genetic Instability ====
When you manifest a power, you may get a message like "It feels like your skin is moving." This is telling you that your genetic instability has gotten higher, and you'll need to be careful not to add too many more powers. All humans can withstand up to '''99 genetic instability''' before they start to bubble and melt. 100 instability would be too much. What happens when you suffer from a genetic breakdown is random and unpredictable, and draws from one of two lists of effects, ranging from 'Mostly Harmless' to 'Dead and Unrevivable'. Negative mutations generally don't give you instability, but powers do. As a rule of thumb, the stronger the power, the more instability it gives. Choose your powers wisely.
==== Chromosome 21 ====
Every time you successfully use an ACTIVATOR on another person, the activator becomes filled with genetic data. Recycle/use it on your DNA console for a 60% chance to gain a random chromosome. The chromosome gets stored in the "Storage - Chromosomes" tab. Clicking on a chromosome gives you information about it. You can also eject it into its physical form. Physical chromosomes can only be used by inserting them into a DNA console. <br><br>
 
Each active mutation in a person has a single chromosome slot. You can only add chromosomes to people who are inside the connected DNA scanner. Do so by opening the ''Sequencer'' tab. Then click an activated mutation, or [[#Manifesting_Mutations|find one]] if none is active yet. You should see the line ''Select a chromosome'' followed by a list of chromosomes that mutation would be compatible with. Select a chromosome in the dropdown menu and you have now filled that mutation's chromosome slot. To delete the chromosome from a mutation you need to deactivate and reactivate the mutation by changing any letter and then back. <br>
 
After you have added a chromosome to a mutation, you can ''store'' it to the ''Storage - mutations'' tab as normal (by clicking ''Save to console'' in the ''Sequencer'' tab). Mutations from mutators/activators printed from this stored entry will then contain that chromosome. The stored entry will retain its applied chromosome if saved to a Genetics data disk and transferred to a different DNA Scanner console.
 
These are the currently available chromosomes you can get (the chance for a chromosome to be of a specific type is listed next to that type in parenthesis):
* '''Synchronizer''' (5/16): Gives the mind more control over the mutation, reducing some downsides by 50%.
* '''Stabilizer''' (1/16): The rarest chromosome. Reduces [[#Genetic_Instability|instability]] gained from the mutation by 20%.
* '''Power''' (5/16): Boosts strength of certain mutations. Experiment with super sneeze or even deadlier fireballs!
* '''Energetic''' (5/16): Reduces cooldown on action based mutations.
* <s>'''Reinforcement''' (3/19): Makes the mutation immune to mutadone.</s> Removed Aug 2020.
 
Chromosomes aren't supposed to be addable to mutations that won't benefit from them. For example, you can't use the energetic chromosome on the monkey mutation.
 
=== What to do with your powers ===
 
* Export your best powers to a disk, as a backup. There's always the risk of an [[AI]] or someone else deleting them for any reason.
* Make injectors to give to <s>[[Assistant|the greytide]]</s> the [[Chain_of_Command#Heads_of_Staff|heads of staff]], the [[Security|security]], or the [[Engineer|Engineers]]. You can also sell them for money!
* Because injectors exist, geneticists may often be asked for powers by randoms. Use your best judgement to decide who gets powers and not, because nothing gets the station down like a herd of assistants with Hulk. Be ready to say "no" a lot. You are allowed to have powers, but if you run around the station while being a hulk don't go on a killing/destroying rampage as that's a bannable offense.
* Enjoy being the peak of human evolution! Use your powers for the greater good, or to make security's life hell by breaking down walls to high security areas and by being unstunnable. Remember that hulks are nonhuman to the AI, though, and when security can't stun someone they'll take out their lethals.
 
=== Healing your subjects and yourself ===
During your experiments, your subjects are likely to get hurt, whether from banging their heads on the tube, or negative mutations—most notably ''H.A.R.S.'' and ''Radioactive''. If unlucky, you may also be hurt. For that, there are several solutions:
* The [[Roboticist]] can build [[Guide_to_robotics#Medibot|medibots]]. The white ones will heal blunt damage, but there also are the green and yellow versions, able to heal tox/rads and burn damage, respectively.
* The [[Chemist|Chemists]] can provide you specific medicines, including [[Guide_to_chemistry#Potassium_Iodide|Potassium Iodide]] for radiations (and toxins in irradiated carbons), [[Guide_to_chemistry#Pentetic_Acid|Pentetic Acid]] for toxins and rads, and several others for burns, brute, or whatever else you may need.
 
Beware that Radioactive subjects may irradiate you and nearby items, so quickly remove that mutation once found.
 
 
=== CRISPR Editing ===
 
This allows you to swap out base mutations in a targeted way. Base mutations don't suffer from [[#Genetic_Instability|instability]]
 
==== Getting a CRISPR Charge ====
First, you'll need to collect a CRISPR charge. This is a sample of a virus with genetic abilities you can use to swap out base mutations.
* Get the Viro to make a virus with either [[Infections#Symptoms_Table|Dormant DNA Activator]] or [[Infections#Symptoms_Table|Viral Evolutionary Acceleration]] (Ideally otherwise benign)
* Have a containment protocol, get yourself scanned for diseases if you get symptoms, hope the cure is available if things go south
* Infect a contained monkey, use an Activator (not a Mutator) on it - it collects the charge when it collects chromosomes
* Feed the used activator to the console to add the charge to the console
 
 
==== Using a CRISPR Charge ====
You'll need the top row of the sequence pairs of both the mutation you want to target and the mutation you want to replace it with. Here's the basic flow:
* Solve the mutation you want or just use a mutator on a humanized monkey
* Take note of the top row
* On the subject you want to swap mutations on, solve the mutation you want to swap
* Use a CRISPR charge on it
* Feed in a special CRISPR string instructing the virus to replace that mutation with the desired mutation
 
===== Building the CRISPR String =====
For example, let's say Epilepsy is
* '''<code>A T T A C G C G A T T A C G C G</code>'''
* '''<code>T A A T G C G C T A A T G C G C</code>'''
 
And Telekinesis is
* '''<code>A T A T C C G G A T T A C C G G</code>'''
* '''<code>T A T A G G C C T A A T G G C C</code>'''


Genes are distorted and twisted by shooting them with radiation. This can be done with the DNA Scanner Access Console and the computer in your lab.
Take note of the first row of both
* Epilepsy is '''<code>A T T A C G C G A T T A C G C G</code>'''
* Telekinesis is '''<code>A T A T C C G G A T T A C C G G</code>'''


==== First Steps ====
You then need to weave these rows together, old-new-old-new-old-new like this:
This guide will start with using a monkey, because they're in the pen for a reason. Keep in mind, though, that this is not the only way. You could use a real life human being for this instead of a monkey, (but be sure that they're willing to give their body to science) but usually monkey's are used to we're using a monkey in this guide.
* '''<code>_A T A T C C G G A T T A C C G G :NEW (Telekinesis)</code>'''
* Start by taking a '''monkey''' from the pen. Knock them out if they're not willing to cooperate.
* '''<code>AATTTAATCCGCCGGGAATTTTAACCGCCGGG :CRISPR String</code>'''
* '''<code>A T T A C G C G A T T A C G C G_ :OLD (Epilepsy)</code>'''


* Shove them into a '''DNA Scanner''' next to the pen.
Now, when you use CRISPR on the solved base mutation you intend to swap, feed in that string! It swaps ''Epilepsy'' out for ''Telekinesis''.
* '''<code> AATTTAATCCGCCGGGAATTTTAACCGCCGGG </code>'''


* Check the '''computer''' next to it, you'll see a bunch of information. Find ''Structural Enzymes'' and try to not confuse them with the other enzyme blocks above.
If your string is not the right length, nothing happens, but if the string is wrong, you may end up with ''Acid Flesh'' instead, but scrambled and with no guides - hope you've got activators! Careful not to be wrong multiple times, lest you overwrite multiple mutations to the same one and need to shuffle to get them back.


At the start of the shift no one has any idea which structural block is which. '''They're all randomized.''' This is why we must do science, experimentation:
Also, the CRISPR charge, being a repurposed virus, might sometimes go rogue and infect you randomly.


==== Humanizing a Monkey + Making a 'Clean SE' ====
<br><br> Congratulations. If you read everything in this guide, you should now be a full-fledged Geneticist.
Changing the monkey into a human should be the first thing you do, because it is by far the easiest block to spot! '''It's the only one with the value higher than 800.'''


# Write yourself a note containing a '''list of 14 blocks'''. You already know the species block, write it down so you remember it.
==DNA Infusion ==
# Decide whether you're going to go from '''lower blocks to higher blocks or vice versa'''. If you're working with a fellow Geneticist, decide together and start working at opposite ends to maximize efficiency. Don't to focus too hard on following an extremely orderly pattern, if another untested block raises to a high level, test it out. Remember to '''share data''' with your fellow Geneticist! When working with a partner, communication is key to efficient work.
Just settling with regular-old mutations not enough? Feel a need to TRANSCEND your human form? Maybe a little too into those weird Japanese cartoons? The brand new DNA infuser located genetics lets you become part BEAST, through... science! All you have to do is stick a corpse of a viable (or not) animal in and a live test subject, and the machine will destroy the corpse to replace one of the test subject's organs with a brand new mutant set. Enough mutant organs from the same type will make you a proper mutant of that type, possibly changing your species or conveying other positive or negative effects!
# Change your '''radiation emitter settings''' to a little more potent so changes will actually happen. Changing the '''''Output Level'' up to 8 and ''Pulse Duration'' to 6''' works fine.
{| class="wikitable"
# '''Click on the species-block's first (leftmost) character to administer radiation''' to it and hope it changes for the better! Repeat this step until the first value on the block is lower than 8. Keep the block '''below 800 for human, and above 800 for monkey'''.
|+
# When you got it, open the DNA Scanner to check if your monkey has turned into a human, if it has, congratulations, you've got your very own monkey-person! If no, check your list which block was the species-block and make sure it's under 8xx and try again.  
!Mutant Type
# Put your test subject back into the DNA Scanner. Time to clean their gene pool.
!Animals with Matching DNA
# Check that '''all of the blocks are less than 800'''. By making this they should have no disabilities nor superpowers, making them perfectly normal. This is called a clean gene-pool or more commonly a "Clean SE". ''Note: Another way of obtaining a Clean SE is by getting a human volunteer to give theirs.''
!Possible Mutant Organs
# After they're clean, let's '''make an injector''' of these SE-settings. On the computer, go to the ''Buffer Menu'' tab, press the ''Save to Buffer'' button, then press the ''Injector'' button next to the SE value. It's also recommended to '''rename the label''' by clicking ''Rename''. This injector now serves you as a "savepoint" which you can come back after an experimentation, making the research faster.
!Organs Required for Set Bonus
!Set Bonus
|-
|Rejected
|Any not listed here
|Fly eyes, proboscis, fly heart, fly lungs,fly liver, fly stomach, fly appendix.
|4
|Turns you into a fully fledged flyperson, like you can become from messing up teleportation. Why the hell would you want to do this?
|-
|Carp
|Space carp
|Carp lungs (Let you breathe in space but NOT on station),  
Carp jaws (Stronger bites and can drop carp teeth, but can't wear anything in mask slot),


Time to go back to the drawing board for a second!
Carp brain (On a timer, gives you a negative moodlet advising you to 'go exploring', IE travel to a different Z-level),


==== How Mutations Work ====
Carp heart.
* Disabilities manifest if the block is over 800.
|4
|Allows you to move freely through space, like a carp can!
|-
|Rat
|Rodents
|Rat eyes (light sensitive but have night vision),
rat stomach, rat heart, rat tongue.
|4
|Gain the ability to crawl through station ventilation, as long as your clothes don't get in the way.
|-
|Goliath
|Goliaths
|Goliath eyes (night vision),
goliath lungs (lets you breathe on lavaland but
NOT on station),


* Power manifesting is a little more complicated. It has an extra randomness added to the random! First off, to be eligible for activation their block must be over C00. After that, every time the subject's dna is updated (either by re-applying the buffer or by pulsing radiation) the power has a chance to manifest. After it has manifested, it won't disappear unless the block goes below C00.
goliath brain (no gloves but one of your arms becomes a
** Telekinesis: '''20% chance to activate.'''
** Hulk: '''15% chance to activate.'''
** Cold Resistance: '''25% chance to activate.'''
** X-Ray Vision: '''25% chance to activate.'''
** Chameleon: '''20% chance to activate.'''
** Dwarfism: '''15% chance to activate.''' For some reason this is a power on the same level as hulk.


Remember that this applies only to mutating via scanner: injectors always manifest powers, if their block is above C00, but are temporary.
tendril hammer),  


==== Manifesting Mutations ====
goliath heart (makes you immune to ash storms.)
Back to business! Now we'll try to make a mutation show itself to us:
|4
|Makes you immune to lava.
|-
|Cat
|Cat
|Cat ears, cat tail.
|N/A
|You're part cat now, just like in those cartoons with those girls you like so much.
|-
|Fox
|Fox
|Fox ears.
|N/A
|You have fox ears, just like that girl on that poster you keep on your wall.
|}
 
==[[File:scanner.gif|32px]][[File:Medcom.gif|32px]][[File:Clone.gif|32px]] Cloning ==
Cloning was removed from the game in Jan, 2020. This is only for historical reference.
<div class="toccolours mw-collapsible mw-collapsed">
Expand for the old guide to cloning.
<div class="mw-collapsible-content">
For a cloning process we need a dead body and cloning equipment, which can be found in your Cloning Room.
 
# First of all, you have to know that for all things cloning, the [[Chief Medical Officer]] has a final say. He is your boss on this side of Genetics. If he tells you to clone someone and not some other guy, you do it. The only person with higher say than him on these matters is the Captain.
# On to the specifics! How to clone: Just '''grab or pull''' a body and stuff it '''into the [[DNA Scanner]] and close the door'''. If you want to remove someone from a Scanner, click on it to open the door. Unless the Scanner is locked, the person/monkey inside is going to pop right out. [[File:Cloning_console_scan_successful.png|thumb|200px|right|This is the cloning console menu.]]
# When the Scanner is occupied, '''interact with the Cloning Console'''. You will see a few options. The most important one is "scan". Click it. If they can be cloned, scanning will succeed regardless of whether they're in their body or not. There are several possible errors that can happen when you try to scan. See the [[#Cloning_Error|section about cloning errors]] for details.
# If scanning is successful, you will get a '''''Successful Scan'' -message'''. That means you now have that person's cloning data saved. You can use this record to steal their genetic data at any time, but cloning is more limited - if their last death happened after they got scanned, any attempts to clone using the scanned record will fail. [[File:Cloning_console_view_records.png|thumb|200px|right|This is what you see after clicking "View Records".]]
# After you actually have DNA data from a person, '''click Check Records''', and then '''click View Record''' of the person who you want to clone. You will see a list of their [[#Unique_Identifiers|UI]](Unique Identifiers) and their [[#Structural_Enzymes|SEs]] (Structural Enzymes). These can be copied and pasted with a cloning data disk (see one of the images to the right). '''Click Clone'''. You will notice that the Cloning Pod is now fully active, with a shadow inside. That is the new body. You can now '''take the old corpse out of the DNA Scanner''', '''strip it completely''' so the cloned person can have their stuff back, and '''place the old corpse inside a body bag in the morgue'''. You don't have to worry about the old corpse anymore. [[File:Cloning_console_view_record_with_disk.png|thumb|200px|right|This is what can you see after clicking a specific "View Record" under "View Records". If you have an ID with cloning access you can delete a record. Otherwise it will say "access denied" when trying to delete it. If you have inserted a "cloning data disk" you have additional options to save or load [[#Unique_Enzymes|UE]], [[#Unique_Identifiers|UI]] and [[#Structural_Enzymes|SE]] (dormant mutations) to and from that disk.]]
# The cloning process takes about 2 or 3 minutes depending on upgrades. For whoever is getting cloned, it may feel like a very long time. While the person is getting their new body formed, take their '''belongings and stuff them all into a locker''', so they're not scattered all over or stolen. Cloning the captain and leaving their ID or other secure items on the floor is bad.
#* '''Aborted cloning:''' Use this as [[traitor]] to screw with that assistant who talked smack to you earlier. During the cloning process, it is possible to eject the incomplete clone by unlocking the Cloning Pod with your ID and ejecting the unfinished clone (needs to be >40% done) or by getting an Engineer to unlock the Genetics APC so you can shut off the power temporarily, which also causes the clone to (instantly, no matter how done) eject. This will usually clone people without limbs or vital organs, making them die quickly.
# The cloned people often have cellular damage. If so, take them to cryo to fix it.
# After the pod is empty, feel free to '''clone your next patient''', and to let the old one out, since they most likely don't have clearance to open the door.
# If R&D has been doing their job, they might upgrade the cloner to a level where it can '''autoprocess'''. If this is the case, you only have to press the Autoprocess button on top of the window, and the cloner will scan and clone automatically. This is useful to process a large pile of bodies quickly. Scan them one at a time, and autoprocess will do the rest.
 
=== [[File:Husk.png|64px|OH GOD OH FUCK]] Hark! A Husk! ===
So you've come across a [[husk]] (a grey corpse) on your floor, which means you can't clone that poor sod without upgrades. Before you go throwing that body in the morgue, they can still be helped!
 
# First off, make sure it's a husk. Throw the body into a DNA Scanner, if it says ''Subject no longer contains the fundamental materials required to create a living clone'', then you have yourself a husk (if your DNA Scanner had been [[Guide_to_advanced_construction#DNA_Scanner|updated]] to the max by the Scientists, you could clone the husk right now. So if you know they've been doing their R&D, ask them).
# Take the body down to [[Surgery]].
# Pester the CMO or a Medical Doctor to extract the brain, or do it yourself.
# Put the brain in the DNA scanner like you would a body.
 
Optionally a husk can be unhusked with [[Guide_to_chemistry#Rezadone|rezadone]]. If all goes well then your cadaver will be reborn. <br>
 
====Changeling Victims====
If examining the husk shows "He/she is limp and unresponsive; there are no signs of life... " it means the body has a soul online. If the corpse still can't be scanned in fully upgraded cloning, it's possible it was someone who got absorbed by a [[Changeling|changeling]]. There appears to be no easy way to revive absorbed victims. Not even through brain transplants.


# Raise a '''new block to over 800''', preferably over '''C00''' and hope something manifests.
=== Helping the Headless ===
# Make sure it is the '''ONLY block''' with over 800, otherwise you might get it mixed up with some other block's symptoms.
Sometimes you'll find a corpse whose head is separated from their body. Thanks to the marvels of modern science, this is not a problem!
# Try to '''figure out the block's function''':
##First switch your target from torso to eyes and turn on the '''penlight''' stored in your suit storage. The penlight is going to be very useful for your work to find blindness / X-Ray.
##To test someone's eyes, use the penlight on the subject's eyes. If you get a ''"[subject]'s pupils narrow!"'', this means their vision is perfect. An ''"eerie glow"'' means X-Ray Vision, and ''"has no reaction"'' means the subject is blind! Fix that ASAP!
##If their vision is perfect, here's a few strategies to figure out what the block does:
###Look at them if you can see anything glowing around their body or head (can be easily spotted without closer examination).
###You can wait for them to curse or have a seizure.
###NOTE: If nothing seems happens at all (even when self-testing), the block might very likely be a power. '''POWERS DO NOT AUTOMATICALLY TURN ON IF OVER THE NEEDED VALUE. THEY HAVE A CERTAIN ''PERCENTAGE'' OF MANIFESTATION EVEN IF THE CONDITIONS ARE PERFECT.''' So if you have a block which does absolutely nothing, keep on trying!
##Ask if a volunteering Assistant can donate their body to science and give verbal feedback on what they feel when you tamper with their blocks or inject them with the SE.
##Or simply self-test like a boss! Note: These options are not the only ones, there are more strategies you can find out.
#Write down what you find and move on to the next block!


==== Self Testing ====
#If you have a head or a brain, just chuck it into the cloner as normal. This may require the DNA scanner to be upgraded though. To clone a head or brain you must throw it into the DNA Scanner by activating throw with '''R''' and then clicking it, or by walking into the DNA scanner and dropping the head/brain. Then click the cloner to close it.
NT recently upgraded the DNA Scanners with a function that allows you to apply a buffer with a delay, effectively allowing you to modify your DNA without someone else manning the console. Using this method is a lot faster, although it will cause some radiation sickness.
#If you don't have the head, but you have the body, not all hope is lost: take a blood sample and give it to the botanist to make a replica pod, and the deceased guy will be reborn as a podperson!
#If you have neither, he's dead for good.


#To start with, keep a Clean SE on a buffer: if you get yourself a disability you want to be able to clear it!
===Cloning Plasmamen===
#Raise a block over 800 on your monkeyman, then save it on a different buffer.
#Get the monkeyman out, press on the '''Occupant - Delayed''' button, and get in the scanner. It will automatically apply the buffer to you.
##If you get a message, check the mutation list to see the effect; if it's a disability you should apply the clean buffer to yourself using the same method.
##If you get no message (be sure that the block is over 800) then the block is a power! Raise the block to over C00, and it will be an active power block.
###Applying an active power block to yourself won't necessarily give you the power; to know which power you're dealing with, you might want to create an injector: it will manifest the power, although temporarily.
#If you got a power, save it on your unused buffer: after that, use that buffer instead of the clean one while testing, so you won't have to reactivate your powers again each time.
#If you reach 100% radiation, you'll collapse: this will knock you out for a few seconds, but it's not as dangerous as it seems. Do remember to take some antitoxin once in a while though.
#When you're satisfied with the powers you have, you can use the scanner to apply them permanently to yourself.


==== Against the Radiation ====
If the patient is a [[plasmaman]], cloning them will be complicated by the fact that the naked patient will burn in the station's atmosphere. This can be dealt with by using showers to keep the patient from catching fire, then dressing them in a plasma envirosuit.
All that radiation pulsing is not healthy.
# Put plasmaman into cloning scanner
# Scan them, start the cloning process
# Drag their dead body to cloning pod
# Undress them and leave their clothes in a pile
# Turn on shower near cloning pod
# Once they pop out of cloner, put them under shower and wait for them to dress up


* At some point it may be a good idea to visit '''[[Chemistry]]''' and order some '''[[Potassium Iodide]]''' for your genetic testing. It's a very useful chem, as it lowers low radiation levels quickly.
If the patient is a naked or beheaded plasmaman, follow these additional steps:
# Once they pop out of cloner, put them under shower and feed them a few [[Guide_to_chemistry#Salbutamol|Salbutamol]] pills (if available), or if desperate, keep a syringe of [[Guide_to_chemistry#Perfluorodecalin|Perfluorodecalin]] ready in case you need it. Plasmamen suffocate if they don't have plasma to breathe!
# Yell at [[Supply_crates|cargo]] to order plasmaman supplies. In the meantime, bug Engineering/Atmos for a filled plasma tank.


* '''[[Anti-Toxin]]''' or '''[[Charcoal]]''' can cure the toxin damage caused by radiation, but does little to the rads themselves.
===Empty Cloning===
Cloners have the option to "Empty Clone" a record, creating a mindless replica of a person. To complement this function, cloners can do Body-Only scans, which can only be used to create empty clones but not real clones, and bypass the sentience restrictions that ordinary scans have. These body-only entries can be deleted without requiring access.


* '''Rejuvinative Chemicals''' can be injected through the DNA Scanner Access Console. They slowly lower radiation (also seem to make the patient's genome more resistant to change).
=== Cloning Errors ===


* If your hair falls out, use a mirror to restore it. You can find one in medbay or in the toilets.
{| class="wikitable"
|-
! Error message
! Cause
! Solution
|-
| Unable to locate valid genetic data.
| Whatever you put inside the scanner doesn't have valid (humanoid) DNA.
| Stop putting bees in the scanner.
|-
| Subject's brain is not responding to scanning stimuli.
| The person inside has suicided or signed an infernal contract. Cloning is impossible.
| Let the [[Cook]] take care of them or put the body in the morgue.
|-
| Subject no longer contains the fundamental materials required to create a living clone.
| You're trying to scan a body that's been husked or smashed by megafauna, but your scanner doesn't have a (tri-)phasic scanning module.
| Remove the brain and scan it. Yell at RnD to upgrade your scanner.
|-
| Mental interface failure.
| The corpse has no ghost associated with it.
| Try again in a few seconds - ghosts get notified when someone attempts to scan their body. No success? Let the [[Cook]] handle it.
|-
| Subject already in database.
| That person has already been scanned.
| Start the cloning process. Want to update the current clone scan? The CMO can delete scan files.
|-
| Initialisation failure.
| The patient is still alive.
| Try again when the patient is dead.
|-
| Unable to initiate cloning cycle.
| Cloning has been disabled in the server config.
| Yell at admins and hand the corpse over to the [[Chef]].
|-
| Corpse has no head.
| [[Changeling|Some asshole]] decapitated your guy - clone scanning is impossible without a brain.
| Draw a blood sample and ask [[Botany]] to clone them with the Replica Pod plant. Can't draw blood either? Your patient is out of luck.
|}


Keep in mind that patching up a corpse with Synthflesh and then reviving it with Strange Reagent bypasses a lot of these issues.


Congratulations. If you read everything is this guide, you should now be a full-fledged Geneticist! Welcome to the club, friend, hope you enjoy it! Pass on the knowledge to those in need.
</div>
</div>


== The Gene Genie - The Traitorous Geneticist ==
== The Gene Genie - The Traitorous Geneticist ==
Sorry for the bad chapter title. I wanted to use that for a very long time.
Sorry for the bad chapter title. I wanted to use that for a very long time.


So, you learned how to do your job successfully, and how to be a credit to the station. You learned how to manipulate genes. Now you want to learn what the hell to do when the syndicate is the one writing your checks! Well, fret not! I will give you some pointers. But these are mostly tips - traitorous objectives differ wildly, and change your actions way too much for me to write a real guide on it.  
So, you learned how to do your job successfully, and how to be a credit to the station. You learned how to manipulate genes. Now you want to learn what the hell to do when the syndicate is the one writing your checks! Well, fret not! I will give you some pointers. But these are mostly tips - traitorous objectives differ wildly, and change your actions way too much for me to write a real guide on it.


=== Rev head ===
=== [[Revolutionary]] ===
Simple. Flash colleagues. If the RD or the CMO come check on you, say you have a good set of powers, but the replicator is offline. Ask for him / her to strip and get in the Scanner. Lock him/her in, have your way with them, they can't leave nor can they talk. Let them enjoy their slow, painful death. If someone wants to clone the captain, that too is pretty simple. Just don't do it. As soon as the guy leaves, stuff the captain in a locker, take his stuff and call it a day. You could also eat until you get fat, transform people into monkeys and eat them. Fun for all. <br>
If you managed to kill a head of staff, copy their identity with a DNA scanner and apply it to yourself. Impersonating a head of staff during a revolution is useful since they are usually exempt from implanting.
Another fun strategy is, if you managed to kill a head of staff, to copy their identity with a DNA scanner and apply it to yourself; impersonating a head of staff during a revolution is easy since they are usually exempt from implanting.


=== Traitor ===
=== [[Traitor]] ===
Depends on your objective. If it's a hard one, like stealing the AI... well, you're fucked. Keep working on those powers! As soon as you have Hulk + TK, go for it as you wish. No tips here.
Depends on your objective. If it's a hard one, like stealing the AI... well, you're fucked. Keep working on those powers! As soon as you have Hulk + TK, go for it as you wish. No tips here.


If your objective is a simple one, though, like stealing the hand tele, there are more approaches to this. As the above tip, you can just break the walls with TK Hulk, but that is rather crass. There's a more roundabout, but classier way to tackle this. Take a monkey from the pen, transform it in a human. Take it's UI+UEs, make an injector, stuff it in your pocket with a label like "Clean Backup - Alexa White".<br/>Now get your own UI+UEs and name it "Clean Backup - Original" or something. Avoid using your name. Now, go hide somewhere close to the item's location, stick yourself with the monkey injector, spawn emag, stick ID and PDA in your backpack. For added stealth, get a different outfit. Emag your way to the captain's room, get his jumpsuit, RUN RUN RUN. The AI might see you, so it would also be good if you spawned an agent card so you can't be tracked. If anyone sees you, they're not going to see your actual name, only the humanized monkey's name. Hide, stick yourself with your own stuff, change clothes, walk away smoothly.
If your objective is a simple one, though, like stealing the hand tele, there are more approaches to this. As the above tip, you can just break the walls with TK Hulk, but that is rather crass. There's a more roundabout, but classier way to tackle this. Take a monkey from the pen, transform it in a human. Take its UI+UEs, make an injector, stuff it in your pocket with a label like "Clean Backup - Alexa White".<br/>Now get your own UI+UEs and name it "Clean Backup - Original" or something. Avoid using your name. Now, go hide somewhere close to the item's location, stick yourself with the monkey injector, spawn doorjack, stick ID and PDA in your backpack. For added stealth, get a different outfit. doorjack your way to the captain's room, get his hand tele, RUN RUN RUN. The AI might see you, so it would also be good if you spawned an agent card so you can't be tracked. If anyone sees you, they're not going to see your actual name, only the humanized monkey's name. Hide, stick yourself with your own stuff, change clothes, walk away smoothly.


If you have to kill someone, same stuff from rev.
If you have to kill someone, same stuff from rev.
Line 330: Line 905:
Also, never forget identity theft. Since you can take someone's complete identity, including looks, you can have some fun with that.
Also, never forget identity theft. Since you can take someone's complete identity, including looks, you can have some fun with that.


=== Wizard ===
=== [[Changeling]] ===
Well... Stealth wizard? Several things you can do, mostly involving UI+UE stuff. Not worth it, really. One thing you can do is taking identities and belongings, but you have to expose yourself to mess with the console. Your choice.
You can DNA sting humanized monkeys to quickly gather stored genomes. Similarly, once people start coming for mutations, you will have plenty of DNA to collect.
 
=== Returning to Monke ===
If you're looking for combat or stealth bonuses, you may use ''Monkified'' to get the monkeys', as well as several useful mutations (e.g., ''Telekinesis'', ''Shock Touch'', ''Chameleon'', ''Gigantism'' and ''Dwarfism'').  
Monkeys have the ability to steal items from people's hands, ventcrawl, and several other benefits. The transformation is unexpensive and available extremely early in the round (unlike the [[Scientist|Xenobiologist's]] slime transformation).
 
{{anchor | Guide_to_gorilla}}
Alternatively, there are [[Critters#Gorilla|gorillas]]. Since the [https://github.com/tgstation/tgstation/pull/62265 radiation modernization changes (Oct, 2021)], you have a nearly-exclusive access to gorillas. You may transform monkeys into gorillas, including yourself, other crewmembers or antagonists.
 
Given their status as a ''simplemob'', gorillas are immune to wounds and most chemicals—essentially the ''Hulk'''s weaknesses. They are additionally immune to stuns and shoves (like Hulks), viruses, and mutations. Unlike Hulks, they are unable to destroy reinforced walls.
* Note that gorillas are thus also immune to the benefits of those, and to surgeries. Healing is going to be more complicated than for hulks, and someone may Lazarus their carcasses to assist against the other gorillas.
 
The gorilla AI is extremely hostile, keeping aggro until their target is dead, and have a tendency to delimb corpses people that are unconscious (incl. hard crit).
 
To transform a monkey into a gorilla, you have two options:
* ''Genetic bombing:'' once above 2500 genetic damage, monkeys have a 25% chance per second to transform.
* ''Mind-Magnification Helmets:'' when removing MM helmets, the sentient monkey has a slight chance (2.5%) to turn into an equally sentient gorilla.
Additionally, the [[Traitor]] geneticist's uplink offers [[Syndicate_Items#Box_of_Gorilla_Cubes|Gorilla Cubes]] and [[Syndicate_Items#Magillitis_Serum_Autoinjector|an autoinjector]] turning them into a gorilla.
 
 


=== Changeling ===
FUCKING REJOICE, your work is cut out for you! Have fun eating the lifeless corpses you clone. Keep in mind that transformations and transformation stings copy SE as well as the UI+UE. Turn people into horribly disabled freaks, or channel a lot of hulk-TK-xray-cold resisting supermen. 
[[Category:Guides]]
[[Category:Guides]]

Latest revision as of 15:21, 7 December 2024

This page needs revising!

The following page is out of date and/or needs to be revised. If the page's guide needs revision, see here for an example.
The revision reason is: "Several new mutations were added and most mutations were tweaked or had values rebalanced in mid-2024, largely from PR #83652. More info needed on changes"

 
Ruth McVork says:
"Welcome to Genetics, brother! Are you feeling good? You SHOULD feel good! You are now like unto a tiny god! Are you prepared to be what you were born to be? Are you ready to save the station (or totally fuck it up)?

Chin up, buddy. It's not that hard. But before you start grabbing those monkeys from the pen, you should know the basics."


The Department

Welcome to Genetics.

This room has two DNA Scanners and two DNA Scanner Access Consoles, along with some disk boxes and other supplies. The disks are extremely useful, as we will see later.

A nearby containment room holds your test subjects. These monkeys are going to be your guinea pigs. You are going to experiment on them, and make them suffer quite a bit. It's pretty inhumane. But such is life, and after a while it will all be worth it.

DNA Modification

This is the "Enzymes" tab. The "Radiation Emitter" function may randomize certain individual cosmetic features of the person inside, as well as damage their DNA. This menu can be used to transfer identities between people, but it can't be used to change a person's species. This information can also be stored on cloning data disks. Regarding the genetic research, listen to the direct orders of the Research Director

.

Now, let's get you acquainted with the DNA Scanner Access Console. It has a few things of note. First you need to learn some terms:

Unique Enzymes

  • Unique Enzymes (UE) = Your name. Even if you mutate the UE it will have no effect on the name. What you can do however, is to transfer UE from one person to another, copying their name.

Unique Identifiers

  • Unique Identifiers (UI) = Your cosmetic details - eye color, skin color, hair style, hair color and gender.

In the DNA scanner access console there is a tab named "Enzymes". This tab can be used to copy UE and UI between people.

  • Click "Save" to save a person's UE + UI to the console. You can not save mutations this way (anymore).
  • Click "Transfer" to copy the genes of the buffer to whoever is inside the scanner. You can choose between Enzymes (UE), Identity (UI) and Full Makeup (UE+UI).
  • Click "Transfer (Delayed)" to copy the genes of the buffer to the next person who steps into the scanner and closes it (such as yourself). This option is only available if the scanner is empty.
  • Click "Print" to print a DNA injector containing the genes of the saved buffer. Injecting this into a person will transfer the UE, UI or UE+UI to that person. Unlike mutation injectors however, these DNA injectors are not permanent, and will only last for a short while after injected.

Structural Enzymes

  • Structural Enzymes (SE) / Genetic Sequence = Your mutations. They contain data relevant to your genetic structure. This governs your race and mutations. The term "Structural Enzymes" is no longer used by the DNA scanner access console since it was replaced with "Genetic Sequence" (which is the same thing), but the term may still show up elsewhere.

Genetic Sequencer

This is what the Sequencer tab may look like with a human in the scanner.

In the DNA scanner access console there is a tab named "Sequencer". Here you will alter genes to find mutations. There are four types of blocks: A, T, C and G. Each pair of letters in the boxes are connected. A goes with T, and G goes with C. Order does not matter. Each pair has a correct combination of "AT, TG, CG or GC" that needs to be filled. If you see a an unmodified pair be X-T it means the right combination of that pair is A-T. When all 16 pairs have the right blocks, the mutation will activate and you will be able to store it. Monkeys can only have the monkified mutation unless humanized. Once you have found the name of a mutation, that mutation will be permanently identified in all DNA scanner access consoles.

You might want to disable the monkey mutation by replacing one of the healthy pairs with another letter. How to do all this will be detailed in the guide below.

Genetic Sequence Scanner

What it looks like after clicking someone with the "Genetic Sequence Scanner" item, and then using the Genetic Sequence Scanner in hand and selecting "Mutation 39". Note that we now know that the first pair should be C-G.

The more difficult mutations will have a lot of unknown (X-X) pairs. You cannot just randomly enter A-T, since it's predetermined what it's supposed to be. Knowing all this, you could whip out the genetic sequence scanner from your pocket. If you're looking for the correct pairs of mutation 39, scan people until you find a person with mutation 39. Then use the scanner in your hand for a menu to pop up. In the menu, select "mutation 39". This gives you a reading which will likely give you more information about which pairs you need to finish mutation 39.

What it looks like after correctly filling all pairs. Mutation 39 turned out to be monkified. Since solving a mutation activates it, the subject in the scanner is now a monkey.


You can use your Genetic Sequence Scanner on a DNA scanner access console to permanently synch the item, which makes you see the names of discovered mutations when scanning people with it.

More info about some of the other tabs can be found in the guide further below.

List of Mutations

Before we start splicing, you must know what possible monstrosities can be done to a human. Normally unobtainable mutations are highlighted in red text.

Mutation Name Description Indicators Message How/Where to Obtain Instability
Telekinesis "A strange mutation that allows the holder to interact with objects through thought."

Subject can control objects with their mind, from far away! It is the most sought after power, since it allows for incredible deeds, and makes a strong robuster nearly immortal. To use it, switch to an empty hand and click on an object (note that, if they can, your character/the game will prioritize picking up an object normally over picking it up telekinetically). A circle symbol will appear underneath the object and in your hand and you can now control the object. Subject can also use any console from a distance.

Appears as a blue glow around the subject's head. "You feel smarter" Genetics / Punished God sect 35
Elastic Arms "Subject's arms have become elastic, allowing them to stretch up to a meter away. However, this elasticity makes it difficult to wear gloves, handle complex tasks, or grab large objects."

Subject can grab objects and interact (help, attack, and grab) with mobs up to two tiles away unless there is a structure, like a table, or mob in the way. They cannot pull others around while using your elastic arms. Their fingers will become chunky, so you can't use guns, batons and computers. Subject also cannot wield items with both hands.

\ "You feel armstrong!" Genetics 35
Hulk "A poorly understood genome that causes the holder's muscles to expand, inhibit speech and gives the person a bad skin condition."

Only works on human subjects. Subject becomes extremely strong, enough to punch through reinforced walls, and is unable to speak without yelling. Subject is also immune to stuns and slowdowns from stamina and normal damage, and cannot be pushed past. Breaking walls and machinery deals heavy brute damage to your arm. This mutation is lost when the subject falls to critical health.

  • Can swing people by their tails. To do this, get your tailed victim in at least a neck grab (lvl 3 grab), enable throw mode, then click in the direction you want to throw.
  • Makes you extra vulnerable to cold and take brute damage from it.
  • Prevent you from using guns, batons and computers, and wielding items with both hands.

This mutation is mutually exclusive with Ork.

Subject turns green and has red eyes. "Your muscles hurt." Radioactive + Strength 35
Ork "A mutation caused by a mixup of hulk genes which severely impacts speech centers in owners' brains."

Works the same as Hulk but you may verbalize some words in Ork Language.

This mutation is mutually exclusive with Hulk.

Subject turns brown and has red eyes. "You feel significantly dumber!" Hulk + Clumsy 35
Cold Adaptation "A strange mutation that renders the host immune to damage from low temperature environments. It also prevents the host from slipping on ice."

This mutation is mutually exclusive with Heat, Thermal, and Pressure Adaptation.

Subject has a pulsating blue "aura". "Your body feels refreshingly cold." Genetics 25
Heat Adaptation "A strange mutation that renders the host immune to damage from high temperature, including being set alight, though the flame itself still burns clothing. It also seems to make the host resist ash storms."

This mutation is mutually exclusive with Cold, Thermal, and Pressure Adaptation.

Subject has a pulsating orange "aura". "Your body feels invigoratingly warm." Genetics 25
Thermal Adaptation "A strange mutation that renders the host immune to damage from both low and high temperature environments. Does not protect from high or low pressure environments."

This mutation is mutually exclusive with Cold, Heat, and Pressure Adaptation.

Subject has a pulsating green "aura". "Your body feels pleasantly room temperature." Genetics 35
Pressure Adaptation "A strange mutation that renders the host immune to damage from both low and high pressure environments. Does not protect from temperature, including the cold of space."

This mutation is mutually exclusive with Cold, Heat, and Thermal Adaptation.

Subject has a pulsating pink "aura". "Your body feels numb." Genetics 25
Thermal Vision "The user of this genome can visually perceive the unique human thermal signature."

Subject can see people even through walls and in darkness for 10 seconds, for the cost of 10 eye damage.

\ "You can see the heat rising off of your skin..." Genetics 35
Chameleon "A genome that causes the holder's skin to become transparent over time."

Subject subtly alters light patterns to become invisible, as long as they remain still.

Subject starts fading into the background. "You feel one with your surroundings." Genetic 35
Dwarfism "A mutation believed to be the cause of dwarfism."

Subject turns into a manlet, making them unusually shorter than the rest of the crew. Dwarfs can pass over tables without stopping and are known to have less tolerance to mutations.

This mutation is mutually exclusive with Acromegaly and Gigantism.

Subject looks smaller. "Everything around you seems to grow.." Human Species 10
Acromegaly "A mutation believed to be the cause of acromegaly, or 'being unusually tall'."

Subject's legs and torso become more extensive. Not the same as Gigantism.

This mutation is mutually exclusive with Dwarfism.

Subject looks taller. "You feel a small strange urge to fight small men with slingshots. Or maybe play some basketball." Spacer Quirk
Gigantism "The cells within the subject spread out to cover more area, making them appear larger."

Subject shows increased tackling abilities, both offensive and defensive. Not the same as Acromegaly.

This mutation is mutually exclusive with Dwarfism.

Subject is slightly larger than normal. "Everything around you seems to shrink.." Genetics 0
Near Sightness "The holder of this mutation has poor eyesight."

Subject displays difficulty to see objects far away. Perscription glasses are recommended.

\ "You can't see very well." Genetics
Epilepsy "A genetic defect that sporadically causes seizures."

Subject periodically falls down and starts shaking.

Subject suffers from seizures. "You get a headache." Genetics
Cough "A chronic cough."

Subject periodically coughs, drop any items they're holding. Substantially harmless, but tends to get on the nerves of the subject.

Subject coughs. "You start coughing." Genetics
Tourette's Syndrome "A chronic twitch that forces the user to scream bad words."

Subject swears all the time and may also periodically experience paralysis.

Subject curses out loudly and twitches. "You twitch." Genetics 0
Nervousness Makes the subject stammer. Annoying at best. Subject stammers when they speak. "You feel nervous." Genetic
Blindness "Renders the subject completely blind." Subject's eyes don't react to penlight. "You can't seem to see anything." Genetics
Deafness "The holder of this genome is completely deaf." \ "You can't seem to hear anything..." Genetics
Illiterate "Causes a severe case of Aphasia that prevents reading or writing."

Subject suffers from illiteracy, becoming unable to use paper, pens, computers, and electronics that require reading.

\ "You feel unable to read or write." Genetics
Clumsiness "A genome that inhibits certain brain functions, causing the holder to appear clumsy. Honk!"

Subject displays inhibition in certain brain functions, inducing clown-like clumsiness. For those that have always wanted to be clowns. It makes the subject accidentally drop things they hold, and unable to use tasers, handcuffs, guns without it exploding in their face.

\ "You feel lightheaded." Genetics / Clowns
Unintelligible Heavily corrupts the part of the brain responsible for forming spoken sentences, causing the subject to only be able to speak short sentences. \ "You can't seem to form any coherent thoughts!" Genetic
Mute Completely shuts down the speech center of the subject's brain. \ "You feel unable to express yourself at all." Genetic / Punished God sect
Wacky Forces the subject to talk in an odd manner. Makes your speech in chat use the Comic Sans font normally only seen with the clown's megaphone. \ "You feel an off sensation in your voicebox." Genetic
Glowy "You permanently emit a light with a random color and intensity."

This mutation is mutually exclusive with Anti-Glow.

Subject glows. "Your skin begins to glow softly." Genetics 5
Anti-Glow "Your skin seems to attract and absorb nearby light creating 'darkness' around you."

Subject absorbs light in a radius around it. Works on Ethereals and Luminescents.

This mutation is mutually exclusive with Glow.

Subject has an aura of darkness. "The light around you seems to disappear." Glowy + Void Magnet 10
Strength "The user's muscles slightly expand. Commonly seen in top-ranking boxers."

Subject displays better fitness and fishing skills, requiring less rest time.

\ "You feel stronger" Genetics 5
Fiery Sweat "The user's skin will randomly combust, but is generally a lot more resilient to burning."

Subject periodically combusts, but grows twice as resistant to fire. Stability decreases the chances of combusting.

This mutation is mutually exclusive with Heat Adaptation.

Subject spontaneously combusts. "You feel hot." Genetics
Void Magnet "A rare genome that attracts odd forces not usually observed."

You have the power to make yourself mostly invincible for a brief period at the cost of being unable to move. You will also enter this state randomly and against your will, genetic stability reduces how often it happens.

Subject is periodically replaced with a hole in reality shaped like the subject. "You feel a heavy, dull force just beyond the walls watching you." Genetic 30
Radioactive "A volatile mutation that causes the host to sent out deadly beta radiation. This affects both the hosts and their surroundings."

One of the few radiation sources after the Radiation Modernization changes.

Subject glows with a green aura "You feel it in your bones" Genetic 5
Telepathy A mutation that allows the user to telepathically communicate to others. Subject is able to broadcast its thought directly to others. "You hear your thoughts echo in your mind" Genetic / Punished God sect 10
Fire Breath An ancient mutation that gives lizards breath of fire.

Enables the user to fire explosive fireballs, hotter the less it travels.

Subject becomes able to breathe concentrated balls of fire. "You feel a heat built up in your throat" Lizard Species 30
Chav Forces the language center of the subject's brain to construct sentences in a more rudimentary manner. \ "Ye feel like a reet prat like, innit?" Genetic
Swedish "A horrible mutation originating from the distant past. Thought to be eradicated after the incident in 2037."

Forces the language center of the subject's brain to construct sentences in a vaguely norse manner.

\ "You feel Swedish, however that works." Genetic
Medieval "A horrible mutation originating from the distant past, thought to have once been a common gene in all of old world Europe."

Forces the language center and primary motor cortex of the subject's brain to talk and act like a knight on a quest for the Holy Grail.

\ "You feel like seeking the holy grail!." Genetic
Pig Latin "Historians say back in the 2020's humanity spoke entirely in this mystical language."

Increase the level of skillchip' complexity the subject can handle.

\ "Omethingsay eelsfay offyay." Genetic 5
Insulated "The affected person does not conduct electricity." Subject does not conduct electricity. "Your fingertips go numb." Genetics 25
Shock Touch "The affected can channel excess electricity through their hands without shocking themselves, allowing them to shock others."

This gives you a non-antag Mansus Grasp that shocks people, which will do burn damage and large amounts of jittering and confusion. Does not protect the subject against shocks.

Subject can electrocute other people with their bare hands. "You feel power flow through your hands." Insulated + Radioactive 30
Transcendent Olfaction "Your sense of smell is comparable to that of a canine."

This power lets you track people by scent. Hold something in your hand and use the power to look for a scent on it. Use the power without holding anything and you'll track the scent you previously found.

\ "Smells begin to make more sense..." Genetic 30
Geladikinesis Allows the user to concentrate moisture and sub-zero forces into snow This mutation lets you create snow, used to build snowtiles, walls, balls and snowmen "Your hand feels cold" Genetic 10
Cryokinesis Draws negative energy from the sub-zero void to shoot freezing beams Lets the user shoot a bolt of cryokinesis to freeze people, objects and tiles "Your hand feels cold" Genetic 20
Antenna The affected person sprouts an antenna. This is known to allow them to access common radio channels passively. An antenna is visible on the user's head, and they basically have a built in station-bounced radio. "You feel an antenna sprout from your forehead." Genetic 5
Mind Reader The affected person can look into the recent memories of others.

They can read the minds of others. This will reveal the name of the target and some snippets of what the target has said in the past. Tin foil is known to block this power.

An antenna is visible on the user's head, and the read-ee may feel something strange enter their mind. "You hear distant voices at the corners of your mind." Antenna + Paranoia / Punished God sect 40
Spatial Instability "The victim of the mutation has a very weak link to spatial reality, and may be displaced. Often causes extreme nausea." Subject randomly teleports a short distance away. "The space around you twists sickeningly." Genetics
Paranoia "Subject is easily terrified, and may suffer from hallucinations." Subject screams frequently. "You feel screams echo through your mind..." Genetics
Two Left Feet "A mutation that replaces the right foot with another left foot. Symptoms include kissing the floor when taking a step." Subject is randomly knocked down. "Your right foot feels... left." Genetics
Tongue Spike Allows a creature to voluntary shoot their tongue out as a deadly weapon.

The tongue does not grow back, and remains embedded in the target until removed.

Subject can shoot his tongue. "Your feel like you can throw your voice." Genetic 15
Stimmed "The user's chemical balance is more robust. This mutation is known to slightly improve workout efficiency." \ "You feel stimmed." Genetic
Chem Spike Allows a creature to voluntary shoot their tongue out as biomass, allowing a long range transfer of chemicals.

The tongue does not grow back, and remains embedded in the target until removed. As long as it is embedded, it allows you to transfer the chemical in your body into the target's, one single time. Much less harmful than Tongue Spike on its own.

Subject can shoot his tongue, and inject you with chemicals. "Your feel like you can really connect with people by throwing your voice." Tongue Spike + Stimmed 15
Webbing Production Allows the user to lay webbing, and travel through it.

Subject may grow psychologically attached to laying webs if used enough.

Subject lays webbing, or can move through some without being slowed down. "Your skin feels webby." Genetic 15
Internal Martyrdom "A mutation that makes the body destruct when near death. Not damaging, but very, VERY disorienting."

Subject melts into gibs upon death. Harmful to witnesses' eyes and paralyzes Silicons.

Subject explodes in a bloody shower when in deep crit. "You get an intense feeling of heartburn." Strong + Stimmed
H.A.R.S. "A mutation that makes the body reject the head, the brain receding into the chest. Stands for Head Allergic Rejection Syndrome. Warning: Removing this mutation is very dangerous, though it will regenerate non-vital head organs." Subject loses their head. "Something feels off." Genetics
Acidic Flesh "Subject has acidic chemicals building up underneath the skin. This is often lethal."

Those buildups end up as acidic cutaneous eruptions, burning the subject. Acid-resistant clothes have been shown to protect the subject from these.

Subject's skin frequently bubbles and pops, burning them. "A horrible burning sensation envelops you as your flesh turns to acid!" Genetics
Spastic "Subject suffers from muscle spasms."

Subject may unintentionnally hit nearby people and machinery, and harm themselves.

Subject frequently spasms. "You flinch." Genetics
Monkified "A strange genome, believing to be what differentiates monkeys from humans."

Subject transforms into a monkey. Innate mutation in humans and monkeys.

Subject frequently spasms. "You feel unusually monkey-like." Genetics
Autotomy "Allows a creature to voluntary discard a random appendage." Subject is able to discard its limbs without surgery. "Your joints feel loose." Genetic 30
Biotech Compatibility "Subject is more compatibile with biotechnology such as skillchips."

Increase the level of skillchip' complexity the subject can handle.

\ No message Genetic 5
Clever "Causes the subject to feel just a little bit smarter. Most effective in specimens with low levels of intelligence."

Allows some mobs, such as monkeys, to perform advanced actions like surgery, use computers and PDAs, and more.

\ "You feel a little bit smarter." Genetic 20
Stoner "A common mutation that severely decreases intelligence."

Grants the Beach Bum language, revokes all the others.

\ "You feel...totally chill, man!" Beach Bum respawn

Chaplain Religion exclusives

Mutations granted by some of the Chaplain's religions. Their instability is set at 0.

"Less of a genome and more of a forceful rewrite of genes. Nothing Nanotrasen supplies allows for a genetic restructure like this..."

Name Description Message
Honorbound "The user feels compelled to follow supposed "rules of combat" but in reality they physically are unable to. Their brain is rewired to excuse any curious inabilities that arise from this odd effect."

Disallows the subject to attack people unless they are attacked first.

"You feel honorbound!"
Burdened "The user feels compelled to injure themselves in various incapacitating and horrific ways. Oddly enough, this gene seems to be connected to several other ones, possibly ready to trigger more genetic changes in the future."

Grants Telepathy and Mute, then Telekinesis and Mind Reader as the subject becomes increasingly burdened through disabilities and debuffs (traumas, missing limbs and organs, addictions, mutations, ...).

"You feel burdened!"

Admin-spawn only mutations

Name Description Indicators Message Instability
X-Ray Vision "A strange genome that allows the user to see between the spaces of walls."

Subject gains the ability to see behind walls. Replaced by the X-Ray implant.

Subject's eyes glow eerily if looked at with a penlight. "The walls suddenly disappear." 35
Laser Eyes "Reflects concentrated light back from the eyes."

Subjects gains the ability to shoot laser beams from their eyes, dealing 25 burn damage.

Subject's eyes glow in red. "You feel pressure building up behind your eyes."
Elvis Forces the language center and primary motor cortex of the subject's brain to talk and act like the King of Rock and Roll. A terrifying mutation named after its 'patient-zero'. "You feel pretty good, honeydoll."
Unstable DNA "Strange mutation that causes the holder to randomly mutate."

Makes the subject randomly mutate. Very dangerous. Definitely be careful with this one.

Subject periodically mutates. "You feel strange."

Guide to finding and using mutations

This guide here shows you step by step how to find the powers from the mysterious blocks!

First Steps

This guide will start with using a monkey, because they're in the pen for a reason.

  • Start by taking a monkey from the pen.
  • Shove it into a DNA Scanner next to the pen, by click dragging.
  • Check the console next to it, you'll see a bunch of options. Find Genetic Sequencer.

All mutations are randomized every round.

Humanizing a Monkey

Always humanize your monkey first, or their powers wont work or be savable.

  1. You and your geneticist buddy automatically share the mutations you've discovered, so work together to discover them all. Saved mutations have to be manually shared between computers using DNA Data Disks.
  2. Click through the mutations and find Monkified. Then break a random pair by changing a letter to X with CTRL+Left Click.
  3. When you've done it, you'll see the name on the top has changed from "monkey" to a randomly generated name. Congratulations, you've got your very own monkey-person!
  4. If for any reason you got yourself some bad mutations and have no one to remove them, grab the mutadone pill bottle in your lab. You usually have several 50u pills available, which is overkill. Dissolve a pill by pouring a tiny amount of water into a beaker (by using the beaker on a sink once), then drop a pill of mutadone into it and take a sip. It should instantly clear all your mutations.
  5. Mutadone will also clear the monkified mutation from monkeys, instantly turning them human. Use a dropper set to 1u to squirt the dissolved mutadone into the eyes of monkeys to mass humanize them without needing any machinery. This will not make you "discover" the monkified mutation however.

Manifesting Mutations

Back to business! Now we'll try to make a mutation show itself to us:

  1. Find a mutation that has broken pairs.
  2. Start filling in the X's. This is fairly easy since most of them are connected to an A, T, C or G. So X-T would be A-T.
    • The left click increments from A to G (A>T>C>G>A) — the right click, the other way around.
  3. You will often find X-X pairs. Make sure the rest is fixed first and then guess it. There's 4 possibilities. AT, TA, GC and CG.
  4. If there's more than 2 double X-pairs, consider using the Genetic Scanner (as described above) by scanning the other monkeys, yourself, or random crew members, or the JOKER option when editing a letter, which finds the correct letter for you (on a very long cooldown—20 minutes on unupgraded scanners).
  5. If completing all pairs didn't work, you may have messed up somewhere. Double check. Also make sure they're not still a monkey. If all else fails, move on to another mutation or scramble their DNA.

Scramble DNA

Clicking the Scramble DNA button will blast the subject's DNA with damaging genetic pulses, and randomize which discoverable mutations it has. This also inflicts a large amount of genetic damage at once.

Activators and Mutators

After manifesting a mutation in the Genetic Sequencer tab, hit store to save it to the "Storage - Mutations" tab. You can print activators and mutators from both the Sequencer and the Storage - Mutations tab.

  • Activators: An activator will permanently activate specific mutation in a person who already has mutation dormant as shown with a Genetic Sequence Scanner . For example, since all humans have the monkified mutation dormant in them, a monkified activator will always work on humans. Using an activator will not increase genetic instability. Used activators can be recycled into the DNA scanner access console to produce chromosomes.
  • Mutators: A mutator will manifest a mutation in a person, regardless of if that person has that mutation dormant or not. This will inflict the mutation's instability (causes several bad effects if it reaches 100%). The mutation and its instability may then be removed by taking Mutadone.


The DNA Scanner Access Console takes time to recharge after producing an activator or mutators. Activators have a much shorter cooldown.

Advanced Injectors

This is the "Adv. Injectors" tab.

After discovering one or more mutations, you have the option to create advanced injectors. Advanced injectors will let you save multiple mutations in a single injector. The amount of mutations in a single "save" is limited to 50 instability or 10 mutations. Unlike activators or ordinary mutators, these can be named anything you want. To create an advanced injector, do the following:

  1. Go to either the "Storage - Adv. Injectors" tab. Click "Create new injector" and choose a name to crate a new slot for mutations to be stored in.
  2. Go to the Sequencer tab or the "Storage - Mutations" tab and click on a stored or discovered and active mutation.
  3. Click "Add to advanced injector". Select the name of the slot you made in step 1. Repeat with any other mutations you wish to save to the same advanced injector.
  4. Go back to the "Adv. Injectors". Click Print. You will print an injector with named "Advanced (name) injector".

Genetic Instability

When you manifest a power, you may get a message like "It feels like your skin is moving." This is telling you that your genetic instability has gotten higher, and you'll need to be careful not to add too many more powers. All humans can withstand up to 99 genetic instability before they start to bubble and melt. 100 instability would be too much. What happens when you suffer from a genetic breakdown is random and unpredictable, and draws from one of two lists of effects, ranging from 'Mostly Harmless' to 'Dead and Unrevivable'. Negative mutations generally don't give you instability, but powers do. As a rule of thumb, the stronger the power, the more instability it gives. Choose your powers wisely.

Chromosome 21

Every time you successfully use an ACTIVATOR on another person, the activator becomes filled with genetic data. Recycle/use it on your DNA console for a 60% chance to gain a random chromosome. The chromosome gets stored in the "Storage - Chromosomes" tab. Clicking on a chromosome gives you information about it. You can also eject it into its physical form. Physical chromosomes can only be used by inserting them into a DNA console.

Each active mutation in a person has a single chromosome slot. You can only add chromosomes to people who are inside the connected DNA scanner. Do so by opening the Sequencer tab. Then click an activated mutation, or find one if none is active yet. You should see the line Select a chromosome followed by a list of chromosomes that mutation would be compatible with. Select a chromosome in the dropdown menu and you have now filled that mutation's chromosome slot. To delete the chromosome from a mutation you need to deactivate and reactivate the mutation by changing any letter and then back.

After you have added a chromosome to a mutation, you can store it to the Storage - mutations tab as normal (by clicking Save to console in the Sequencer tab). Mutations from mutators/activators printed from this stored entry will then contain that chromosome. The stored entry will retain its applied chromosome if saved to a Genetics data disk and transferred to a different DNA Scanner console.

These are the currently available chromosomes you can get (the chance for a chromosome to be of a specific type is listed next to that type in parenthesis):

  • Synchronizer (5/16): Gives the mind more control over the mutation, reducing some downsides by 50%.
  • Stabilizer (1/16): The rarest chromosome. Reduces instability gained from the mutation by 20%.
  • Power (5/16): Boosts strength of certain mutations. Experiment with super sneeze or even deadlier fireballs!
  • Energetic (5/16): Reduces cooldown on action based mutations.
  • Reinforcement (3/19): Makes the mutation immune to mutadone. Removed Aug 2020.

Chromosomes aren't supposed to be addable to mutations that won't benefit from them. For example, you can't use the energetic chromosome on the monkey mutation.

What to do with your powers

  • Export your best powers to a disk, as a backup. There's always the risk of an AI or someone else deleting them for any reason.
  • Make injectors to give to the greytide the heads of staff, the security, or the Engineers. You can also sell them for money!
  • Because injectors exist, geneticists may often be asked for powers by randoms. Use your best judgement to decide who gets powers and not, because nothing gets the station down like a herd of assistants with Hulk. Be ready to say "no" a lot. You are allowed to have powers, but if you run around the station while being a hulk don't go on a killing/destroying rampage as that's a bannable offense.
  • Enjoy being the peak of human evolution! Use your powers for the greater good, or to make security's life hell by breaking down walls to high security areas and by being unstunnable. Remember that hulks are nonhuman to the AI, though, and when security can't stun someone they'll take out their lethals.

Healing your subjects and yourself

During your experiments, your subjects are likely to get hurt, whether from banging their heads on the tube, or negative mutations—most notably H.A.R.S. and Radioactive. If unlucky, you may also be hurt. For that, there are several solutions:

  • The Roboticist can build medibots. The white ones will heal blunt damage, but there also are the green and yellow versions, able to heal tox/rads and burn damage, respectively.
  • The Chemists can provide you specific medicines, including Potassium Iodide for radiations (and toxins in irradiated carbons), Pentetic Acid for toxins and rads, and several others for burns, brute, or whatever else you may need.

Beware that Radioactive subjects may irradiate you and nearby items, so quickly remove that mutation once found.


CRISPR Editing

This allows you to swap out base mutations in a targeted way. Base mutations don't suffer from instability

Getting a CRISPR Charge

First, you'll need to collect a CRISPR charge. This is a sample of a virus with genetic abilities you can use to swap out base mutations.

  • Get the Viro to make a virus with either Dormant DNA Activator or Viral Evolutionary Acceleration (Ideally otherwise benign)
  • Have a containment protocol, get yourself scanned for diseases if you get symptoms, hope the cure is available if things go south
  • Infect a contained monkey, use an Activator (not a Mutator) on it - it collects the charge when it collects chromosomes
  • Feed the used activator to the console to add the charge to the console


Using a CRISPR Charge

You'll need the top row of the sequence pairs of both the mutation you want to target and the mutation you want to replace it with. Here's the basic flow:

  • Solve the mutation you want or just use a mutator on a humanized monkey
  • Take note of the top row
  • On the subject you want to swap mutations on, solve the mutation you want to swap
  • Use a CRISPR charge on it
  • Feed in a special CRISPR string instructing the virus to replace that mutation with the desired mutation
Building the CRISPR String

For example, let's say Epilepsy is

  • A T T A C G C G A T T A C G C G
  • T A A T G C G C T A A T G C G C

And Telekinesis is

  • A T A T C C G G A T T A C C G G
  • T A T A G G C C T A A T G G C C

Take note of the first row of both

  • Epilepsy is A T T A C G C G A T T A C G C G
  • Telekinesis is A T A T C C G G A T T A C C G G

You then need to weave these rows together, old-new-old-new-old-new like this:

  • _A T A T C C G G A T T A C C G G :NEW (Telekinesis)
  • AATTTAATCCGCCGGGAATTTTAACCGCCGGG :CRISPR String
  • A T T A C G C G A T T A C G C G_ :OLD (Epilepsy)

Now, when you use CRISPR on the solved base mutation you intend to swap, feed in that string! It swaps Epilepsy out for Telekinesis.

  • AATTTAATCCGCCGGGAATTTTAACCGCCGGG

If your string is not the right length, nothing happens, but if the string is wrong, you may end up with Acid Flesh instead, but scrambled and with no guides - hope you've got activators! Careful not to be wrong multiple times, lest you overwrite multiple mutations to the same one and need to shuffle to get them back.

Also, the CRISPR charge, being a repurposed virus, might sometimes go rogue and infect you randomly.



Congratulations. If you read everything in this guide, you should now be a full-fledged Geneticist.

DNA Infusion

Just settling with regular-old mutations not enough? Feel a need to TRANSCEND your human form? Maybe a little too into those weird Japanese cartoons? The brand new DNA infuser located genetics lets you become part BEAST, through... science! All you have to do is stick a corpse of a viable (or not) animal in and a live test subject, and the machine will destroy the corpse to replace one of the test subject's organs with a brand new mutant set. Enough mutant organs from the same type will make you a proper mutant of that type, possibly changing your species or conveying other positive or negative effects!

Mutant Type Animals with Matching DNA Possible Mutant Organs Organs Required for Set Bonus Set Bonus
Rejected Any not listed here Fly eyes, proboscis, fly heart, fly lungs,fly liver, fly stomach, fly appendix. 4 Turns you into a fully fledged flyperson, like you can become from messing up teleportation. Why the hell would you want to do this?
Carp Space carp Carp lungs (Let you breathe in space but NOT on station),

Carp jaws (Stronger bites and can drop carp teeth, but can't wear anything in mask slot),

Carp brain (On a timer, gives you a negative moodlet advising you to 'go exploring', IE travel to a different Z-level),

Carp heart.

4 Allows you to move freely through space, like a carp can!
Rat Rodents Rat eyes (light sensitive but have night vision),

rat stomach, rat heart, rat tongue.

4 Gain the ability to crawl through station ventilation, as long as your clothes don't get in the way.
Goliath Goliaths Goliath eyes (night vision),

goliath lungs (lets you breathe on lavaland but NOT on station),

goliath brain (no gloves but one of your arms becomes a

tendril hammer),

goliath heart (makes you immune to ash storms.)

4 Makes you immune to lava.
Cat Cat Cat ears, cat tail. N/A You're part cat now, just like in those cartoons with those girls you like so much.
Fox Fox Fox ears. N/A You have fox ears, just like that girl on that poster you keep on your wall.

Cloning

Cloning was removed from the game in Jan, 2020. This is only for historical reference.

Expand for the old guide to cloning.

For a cloning process we need a dead body and cloning equipment, which can be found in your Cloning Room.

  1. First of all, you have to know that for all things cloning, the Chief Medical Officer has a final say. He is your boss on this side of Genetics. If he tells you to clone someone and not some other guy, you do it. The only person with higher say than him on these matters is the Captain.
  2. On to the specifics! How to clone: Just grab or pull a body and stuff it into the DNA Scanner and close the door. If you want to remove someone from a Scanner, click on it to open the door. Unless the Scanner is locked, the person/monkey inside is going to pop right out.
    This is the cloning console menu.
  3. When the Scanner is occupied, interact with the Cloning Console. You will see a few options. The most important one is "scan". Click it. If they can be cloned, scanning will succeed regardless of whether they're in their body or not. There are several possible errors that can happen when you try to scan. See the section about cloning errors for details.
  4. If scanning is successful, you will get a Successful Scan -message. That means you now have that person's cloning data saved. You can use this record to steal their genetic data at any time, but cloning is more limited - if their last death happened after they got scanned, any attempts to clone using the scanned record will fail.
    This is what you see after clicking "View Records".
  5. After you actually have DNA data from a person, click Check Records, and then click View Record of the person who you want to clone. You will see a list of their UI(Unique Identifiers) and their SEs (Structural Enzymes). These can be copied and pasted with a cloning data disk (see one of the images to the right). Click Clone. You will notice that the Cloning Pod is now fully active, with a shadow inside. That is the new body. You can now take the old corpse out of the DNA Scanner, strip it completely so the cloned person can have their stuff back, and place the old corpse inside a body bag in the morgue. You don't have to worry about the old corpse anymore.
    This is what can you see after clicking a specific "View Record" under "View Records". If you have an ID with cloning access you can delete a record. Otherwise it will say "access denied" when trying to delete it. If you have inserted a "cloning data disk" you have additional options to save or load UE, UI and SE (dormant mutations) to and from that disk.
  6. The cloning process takes about 2 or 3 minutes depending on upgrades. For whoever is getting cloned, it may feel like a very long time. While the person is getting their new body formed, take their belongings and stuff them all into a locker, so they're not scattered all over or stolen. Cloning the captain and leaving their ID or other secure items on the floor is bad.
    • Aborted cloning: Use this as traitor to screw with that assistant who talked smack to you earlier. During the cloning process, it is possible to eject the incomplete clone by unlocking the Cloning Pod with your ID and ejecting the unfinished clone (needs to be >40% done) or by getting an Engineer to unlock the Genetics APC so you can shut off the power temporarily, which also causes the clone to (instantly, no matter how done) eject. This will usually clone people without limbs or vital organs, making them die quickly.
  7. The cloned people often have cellular damage. If so, take them to cryo to fix it.
  8. After the pod is empty, feel free to clone your next patient, and to let the old one out, since they most likely don't have clearance to open the door.
  9. If R&D has been doing their job, they might upgrade the cloner to a level where it can autoprocess. If this is the case, you only have to press the Autoprocess button on top of the window, and the cloner will scan and clone automatically. This is useful to process a large pile of bodies quickly. Scan them one at a time, and autoprocess will do the rest.

OH GOD OH FUCK Hark! A Husk!

So you've come across a husk (a grey corpse) on your floor, which means you can't clone that poor sod without upgrades. Before you go throwing that body in the morgue, they can still be helped!

  1. First off, make sure it's a husk. Throw the body into a DNA Scanner, if it says Subject no longer contains the fundamental materials required to create a living clone, then you have yourself a husk (if your DNA Scanner had been updated to the max by the Scientists, you could clone the husk right now. So if you know they've been doing their R&D, ask them).
  2. Take the body down to Surgery.
  3. Pester the CMO or a Medical Doctor to extract the brain, or do it yourself.
  4. Put the brain in the DNA scanner like you would a body.

Optionally a husk can be unhusked with rezadone. If all goes well then your cadaver will be reborn.

Changeling Victims

If examining the husk shows "He/she is limp and unresponsive; there are no signs of life... " it means the body has a soul online. If the corpse still can't be scanned in fully upgraded cloning, it's possible it was someone who got absorbed by a changeling. There appears to be no easy way to revive absorbed victims. Not even through brain transplants.

Helping the Headless

Sometimes you'll find a corpse whose head is separated from their body. Thanks to the marvels of modern science, this is not a problem!

  1. If you have a head or a brain, just chuck it into the cloner as normal. This may require the DNA scanner to be upgraded though. To clone a head or brain you must throw it into the DNA Scanner by activating throw with R and then clicking it, or by walking into the DNA scanner and dropping the head/brain. Then click the cloner to close it.
  2. If you don't have the head, but you have the body, not all hope is lost: take a blood sample and give it to the botanist to make a replica pod, and the deceased guy will be reborn as a podperson!
  3. If you have neither, he's dead for good.

Cloning Plasmamen

If the patient is a plasmaman, cloning them will be complicated by the fact that the naked patient will burn in the station's atmosphere. This can be dealt with by using showers to keep the patient from catching fire, then dressing them in a plasma envirosuit.

  1. Put plasmaman into cloning scanner
  2. Scan them, start the cloning process
  3. Drag their dead body to cloning pod
  4. Undress them and leave their clothes in a pile
  5. Turn on shower near cloning pod
  6. Once they pop out of cloner, put them under shower and wait for them to dress up

If the patient is a naked or beheaded plasmaman, follow these additional steps:

  1. Once they pop out of cloner, put them under shower and feed them a few Salbutamol pills (if available), or if desperate, keep a syringe of Perfluorodecalin ready in case you need it. Plasmamen suffocate if they don't have plasma to breathe!
  2. Yell at cargo to order plasmaman supplies. In the meantime, bug Engineering/Atmos for a filled plasma tank.

Empty Cloning

Cloners have the option to "Empty Clone" a record, creating a mindless replica of a person. To complement this function, cloners can do Body-Only scans, which can only be used to create empty clones but not real clones, and bypass the sentience restrictions that ordinary scans have. These body-only entries can be deleted without requiring access.

Cloning Errors

Error message Cause Solution
Unable to locate valid genetic data. Whatever you put inside the scanner doesn't have valid (humanoid) DNA. Stop putting bees in the scanner.
Subject's brain is not responding to scanning stimuli. The person inside has suicided or signed an infernal contract. Cloning is impossible. Let the Cook take care of them or put the body in the morgue.
Subject no longer contains the fundamental materials required to create a living clone. You're trying to scan a body that's been husked or smashed by megafauna, but your scanner doesn't have a (tri-)phasic scanning module. Remove the brain and scan it. Yell at RnD to upgrade your scanner.
Mental interface failure. The corpse has no ghost associated with it. Try again in a few seconds - ghosts get notified when someone attempts to scan their body. No success? Let the Cook handle it.
Subject already in database. That person has already been scanned. Start the cloning process. Want to update the current clone scan? The CMO can delete scan files.
Initialisation failure. The patient is still alive. Try again when the patient is dead.
Unable to initiate cloning cycle. Cloning has been disabled in the server config. Yell at admins and hand the corpse over to the Chef.
Corpse has no head. Some asshole decapitated your guy - clone scanning is impossible without a brain. Draw a blood sample and ask Botany to clone them with the Replica Pod plant. Can't draw blood either? Your patient is out of luck.

Keep in mind that patching up a corpse with Synthflesh and then reviving it with Strange Reagent bypasses a lot of these issues.

The Gene Genie - The Traitorous Geneticist

Sorry for the bad chapter title. I wanted to use that for a very long time.

So, you learned how to do your job successfully, and how to be a credit to the station. You learned how to manipulate genes. Now you want to learn what the hell to do when the syndicate is the one writing your checks! Well, fret not! I will give you some pointers. But these are mostly tips - traitorous objectives differ wildly, and change your actions way too much for me to write a real guide on it.

Revolutionary

If you managed to kill a head of staff, copy their identity with a DNA scanner and apply it to yourself. Impersonating a head of staff during a revolution is useful since they are usually exempt from implanting.

Traitor

Depends on your objective. If it's a hard one, like stealing the AI... well, you're fucked. Keep working on those powers! As soon as you have Hulk + TK, go for it as you wish. No tips here.

If your objective is a simple one, though, like stealing the hand tele, there are more approaches to this. As the above tip, you can just break the walls with TK Hulk, but that is rather crass. There's a more roundabout, but classier way to tackle this. Take a monkey from the pen, transform it in a human. Take its UI+UEs, make an injector, stuff it in your pocket with a label like "Clean Backup - Alexa White".
Now get your own UI+UEs and name it "Clean Backup - Original" or something. Avoid using your name. Now, go hide somewhere close to the item's location, stick yourself with the monkey injector, spawn doorjack, stick ID and PDA in your backpack. For added stealth, get a different outfit. doorjack your way to the captain's room, get his hand tele, RUN RUN RUN. The AI might see you, so it would also be good if you spawned an agent card so you can't be tracked. If anyone sees you, they're not going to see your actual name, only the humanized monkey's name. Hide, stick yourself with your own stuff, change clothes, walk away smoothly.

If you have to kill someone, same stuff from rev.

Also, never forget identity theft. Since you can take someone's complete identity, including looks, you can have some fun with that.

Changeling

You can DNA sting humanized monkeys to quickly gather stored genomes. Similarly, once people start coming for mutations, you will have plenty of DNA to collect.

Returning to Monke

If you're looking for combat or stealth bonuses, you may use Monkified to get the monkeys', as well as several useful mutations (e.g., Telekinesis, Shock Touch, Chameleon, Gigantism and Dwarfism). Monkeys have the ability to steal items from people's hands, ventcrawl, and several other benefits. The transformation is unexpensive and available extremely early in the round (unlike the Xenobiologist's slime transformation).

Alternatively, there are gorillas. Since the radiation modernization changes (Oct, 2021), you have a nearly-exclusive access to gorillas. You may transform monkeys into gorillas, including yourself, other crewmembers or antagonists.

Given their status as a simplemob, gorillas are immune to wounds and most chemicals—essentially the Hulk's weaknesses. They are additionally immune to stuns and shoves (like Hulks), viruses, and mutations. Unlike Hulks, they are unable to destroy reinforced walls.

  • Note that gorillas are thus also immune to the benefits of those, and to surgeries. Healing is going to be more complicated than for hulks, and someone may Lazarus their carcasses to assist against the other gorillas.

The gorilla AI is extremely hostile, keeping aggro until their target is dead, and have a tendency to delimb corpses people that are unconscious (incl. hard crit).

To transform a monkey into a gorilla, you have two options:

  • Genetic bombing: once above 2500 genetic damage, monkeys have a 25% chance per second to transform.
  • Mind-Magnification Helmets: when removing MM helmets, the sentient monkey has a slight chance (2.5%) to turn into an equally sentient gorilla.

Additionally, the Traitor geneticist's uplink offers Gorilla Cubes and an autoinjector turning them into a gorilla.